View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9369_low_41 (Length: 307)
Name: NF9369_low_41
Description: NF9369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9369_low_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 35133009 - 35132747
Alignment:
| Q |
1 |
ctatagaggtgtttacaagcaaaaggatgttgcaattaagcttgtgagtcagcctgaagaagatgaagatttggcttcttttcttgagaagcaatttact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35133009 |
ctatagaggtgtttacaagcaaaaggatgttgcaattaagcttgtgagtcagcctgaagaagatgaagatttggcttcttttcttgagaagcaatttact |
35132910 |
T |
 |
| Q |
101 |
tctgaagttgctttgcttctgaggttgcgtcatccaaatattcttactgtaagtccttgtgctttcttcaatcatccctctgttagtttcattgtactct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
35132909 |
tctgaagttgctttgcttctgaggttgcgtcatccaaatattcttactgtaagtccttgtgctttcttcaatcatccctctgttagtttcattgtactgt |
35132810 |
T |
 |
| Q |
201 |
tcctgcattttcattcatctttgtttttgggtcttttttattgctgctaaaacaagatgtatg |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35132809 |
tcctgcattttcattcatctttgtttttgggtcttttttactgctgctaaaacaagatgtatg |
35132747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 25 - 117
Target Start/End: Complemental strand, 43933406 - 43933314
Alignment:
| Q |
25 |
ggatgttgcaattaagcttgtgagtcagcctgaagaagatgaagatttggcttcttttcttgagaagcaatttacttctgaagttgctttgct |
117 |
Q |
| |
|
||||||||| ||||||||||| ||||| || ||||| ||||| || |||||| |||| |||||||| || ||||||||||| ||||||||||| |
|
|
| T |
43933406 |
ggatgttgctattaagcttgttagtcaaccagaagaggatgaggaattggctgctttgcttgagaaacactttacttctgaggttgctttgct |
43933314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University