View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9369_low_50 (Length: 272)
Name: NF9369_low_50
Description: NF9369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9369_low_50 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 270
Target Start/End: Complemental strand, 7398584 - 7398313
Alignment:
| Q |
1 |
ttgaaaggatgcagtgcatcatatcttcgnnnnnnn-tatatcaacatctatttttctttaggtttttattgttatatattaaatttcaataacatgaaa |
99 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7398584 |
ttgaaaggatgcagtgcatcataacttcgaaaaaaaatatatcaacatctatttttctttagctttttattgttatatattaaatttcaataacatgaaa |
7398485 |
T |
|
| Q |
100 |
ttattgtattaaaatgtacttgttttcatcattctcatttagattgtaaatcaatgaaaattatactt-ttattagcaatacaaatatatggttaaaaat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7398484 |
ttattgtattaaaatgtacttgttttcatcattctcatttagattgtaaatccatgaaaattatacttaatattagcaatacaaatatatggttaaaaat |
7398385 |
T |
|
| Q |
199 |
actgttagggtttaagaaatgcagattctgatgtgcgtcttacacgaaggattcaacgtctcgccattgaac |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7398384 |
actgttagggtttaagaaatgcagattctgatgtgcgtcttacacgaaggattcaacgtctcgccattgaac |
7398313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University