View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9369_low_68 (Length: 239)
Name: NF9369_low_68
Description: NF9369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9369_low_68 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 12 - 220
Target Start/End: Original strand, 41066694 - 41066902
Alignment:
| Q |
12 |
agcaaaggttaaagaaaaggacaaagtggaagcattgtacaagcatgtgtggaacttcagtacgtgcggaagatatataaaagaaatgactcatatagtt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41066694 |
agcaaaggttaaagaaaaggacaaagtggaagcattgtacaagcatgtgtggaacttcagtacgtgcggaagatatataaaagaaatgactcatatagtt |
41066793 |
T |
|
| Q |
112 |
cgccccttaaagttttaagtaaagatgttgtgttcgtttctcttgatgattctattaaccaaatactcacttcgtctcataactagcattccgttacatt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41066794 |
cgccccttaaagttttaagtaaagatgttgtgttcgtttctcttgatgattctattaactaaatactcacttcgtctcataactagcgttccgttacatt |
41066893 |
T |
|
| Q |
212 |
tgcattact |
220 |
Q |
| |
|
||||||||| |
|
|
| T |
41066894 |
tgcattact |
41066902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University