View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9369_low_73 (Length: 222)
Name: NF9369_low_73
Description: NF9369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9369_low_73 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 23 - 207
Target Start/End: Original strand, 54075516 - 54075697
Alignment:
| Q |
23 |
aaatttcatattgtatgataatggaagcgatgatgatgatgatttggagagaataattaaggagctttgtgaagagggttataatataagcacgttgctt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
54075516 |
aaatttcatattgtatgataatggaagcgatg---atgatgatttggagagaataattaaggagcttcgtgaagagggttataatataagcacgttgctt |
54075612 |
T |
 |
| Q |
123 |
tggatttggcctaagactcaagaagctggattctctcacagtattttgtactcaaaatccaaaggattatgcacttggatgatgt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54075613 |
tggatttggcctaagactcaagaagctggattctcacacagtattttgtactcaaaatccaaaggattatgcacttggatgatgt |
54075697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University