View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9370_high_11 (Length: 314)
Name: NF9370_high_11
Description: NF9370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9370_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 133 - 301
Target Start/End: Original strand, 42549805 - 42549973
Alignment:
| Q |
133 |
acaaacccgcatgtttttcacctacttctctacaccatcaaataatcccaaaatgggtctaatgaacaacactacagatacacatatctaaaatagtgaa |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42549805 |
acaaacccgcatgtttttcacctacttctctacaccatcaaataatcccaaaatgggtctaatgaacaacactgcagatacacatatctaaaatagtgaa |
42549904 |
T |
 |
| Q |
233 |
cccataaaaatcaaacaaaatcaaaaggttcaccatattcagcaacctccatctttgtttcattcagta |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
42549905 |
cccataaaaatcaaacaaaatcaaaaggttcaccattttcagcaacctccgtctttgtttcattcagta |
42549973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 18 - 108
Target Start/End: Original strand, 42549693 - 42549783
Alignment:
| Q |
18 |
aagccaattatatgcttctccttgtattaatccaaaccctagacatcacaaaaaacaaatcttcagcttccacaacacaagcccacatgta |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42549693 |
aagccaattatatgcttctccttgtattaatccaaaccctagacatcacaaaaaacaaatcttcagcttccacaacacaagcccacatgta |
42549783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University