View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9370_low_49 (Length: 237)
Name: NF9370_low_49
Description: NF9370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9370_low_49 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 16 - 220
Target Start/End: Complemental strand, 33655057 - 33654853
Alignment:
| Q |
16 |
cacttctttttgtcaatgcaatgataatatagaaattaagtggataagatactacaattccacgtttgtttgggtggatgttttgatatatggcagaaga |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33655057 |
cacttctttttgtcaatgcaatgataatatagatattaagtggataagatactacaattccacgtttgtttgggtggatgttttgatatatggcagaaga |
33654958 |
T |
 |
| Q |
116 |
ctgagtaaacgattttatgtgtggacaaataaaacaagaaaatgacatgaaaattggggtggcatttagcatgaggctatgaataaactactccaccata |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33654957 |
ctgagtaaacgattttatgtgtggacaaataaaacaagaaaatgacatgaaaactggggtggcatttagcatgagcctatgaataaactactccaccata |
33654858 |
T |
 |
| Q |
216 |
gttct |
220 |
Q |
| |
|
||||| |
|
|
| T |
33654857 |
gttct |
33654853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University