View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9371_high_14 (Length: 312)
Name: NF9371_high_14
Description: NF9371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9371_high_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 27 - 112
Target Start/End: Original strand, 14567344 - 14567433
Alignment:
| Q |
27 |
ttacacaaacaagacaagtggatttagtcttgcacattccaaagtcaaaattcaaa----tatacaaaattgatttcaatttattaagaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14567344 |
ttacacaaacaagacaagtggatttagtcttgcacattccaaagtcaaaattcaaataagtatacaaaattgatttcaatttattaagaa |
14567433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 209 - 268
Target Start/End: Complemental strand, 24210876 - 24210817
Alignment:
| Q |
209 |
tagaccagggcttattagagttctcaagattgtaggactcgccgtctaagaaataaggaa |
268 |
Q |
| |
|
||||| |||| ||||||| ||||||||||||||||||||| | || ||||||||||||| |
|
|
| T |
24210876 |
tagacaagggtttattagggttctcaagattgtaggactcacaatcaaagaaataaggaa |
24210817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University