View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9371_high_15 (Length: 312)
Name: NF9371_high_15
Description: NF9371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9371_high_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 295
Target Start/End: Original strand, 26528502 - 26528793
Alignment:
| Q |
1 |
gtgaaatgttgttactatttattggaggctatgcctctaccaggacctacatggtctacaactggacctactgtattggctgagccaccatcatcactta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || | |
|
|
| T |
26528502 |
gtgaaatgttgttactatttattggaggctatgcctctaccaggacctacatggtctacaactggacctactatattggctgagccaccatca---ctca |
26528598 |
T |
|
| Q |
101 |
ttgaagcttctatggaattagagttgggagaaaacaaccaagcttcttcatatacttggtggcttggatttcttgaaggtttagatggaaatatgagcat |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26528599 |
ttgaagcttctatggagttagagttgggagaaaacaaccaagcttcttcatatacttggtggcttggatttcttaaaggtttagatggaaatatgagcat |
26528698 |
T |
|
| Q |
201 |
tgagnnnnnnntggaaaaggaaattgtgatggaacataataaaggggttagctttgagtcaaaatttgttgatgcaattgatcttggttgttgtc |
295 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26528699 |
tgagaaaaaaatggaaaaggaaattgtgatggaacataataaaggggttagctttgagtcaaaatttgtggatgcaattgatcttggttgttgtc |
26528793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University