View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9371_high_17 (Length: 292)
Name: NF9371_high_17
Description: NF9371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9371_high_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 41 - 274
Target Start/End: Complemental strand, 41305184 - 41304969
Alignment:
| Q |
41 |
tgtcttttctctgcttttatatgtcttctcattttcactctttctgttgcgttgcaattggaaaaataaataataaatcatcaatttcattgttatcatt |
140 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41305184 |
tgtcttttctctgcttttatatatcttctcattttcactctttctgttgc-----aattggaaaaataaataataaatcatcaattt------------- |
41305103 |
T |
|
| Q |
141 |
taggattttaatgttatgatgttgctgagcccaactactgagaatatactttgattgttatgttaatgttgtattaatcagaaaattttaaaatcattat |
240 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41305102 |
taggattataatgttatgatgttgctgagcccaattactgagaatatactttgattgttatgttaatgttgtattaatcagaaaattttaaaatcattat |
41305003 |
T |
|
| Q |
241 |
tgtacaaacaatgttgtcaaatggtggctatagc |
274 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
41305002 |
tgtacaaacaatgttgtcaaatggcggctatagc |
41304969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University