View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9371_low_13 (Length: 438)
Name: NF9371_low_13
Description: NF9371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9371_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 417; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 417; E-Value: 0
Query Start/End: Original strand, 1 - 421
Target Start/End: Original strand, 14420618 - 14421038
Alignment:
| Q |
1 |
gcaacacaatttgattcagaaagaccagtaatttatgattttgaggagattgaacatgctacaaataactttgatgaaactagaaggattggagttggtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14420618 |
gcaacacaatttgattcagaaagaccagtaatttatgattttgaggagattgaacatgctacaaataactttgatgaaactagaaggattggagttggtg |
14420717 |
T |
 |
| Q |
101 |
gatatggtactgtctattttggaatgctggaggagaaggtaaggaaaattctgcattgattctttaatgttcattaataattcaatcatattttttcata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14420718 |
gatatggtactgtctattttggaatgctggaggagaaggtaaggaaaattctgcattgattctttaatgctcattaataattcaatcatattttttcata |
14420817 |
T |
 |
| Q |
201 |
tgctaactaaaaattggacaataacatcttttaggaggttgctgtgaagaaaatgaagtctaacaaatccaaagagttctatgcagaactcaaagcctta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14420818 |
tgctaactaaaaattggacaataacatcttttaggaggttgctgtgaagaaaatgaagtctaacaaatccaaagagttctatgcagaactcaaagcctta |
14420917 |
T |
 |
| Q |
301 |
tgcaaaatccatcatatcaatattgtatgttataattatctttgacatattggatttcctgcatttagcaatatcatgcattaacgcagcagtcaataca |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14420918 |
tgcaaaatccatcatatcaatattgtatgttataattatctttgacatattggatttcctgcatttagcaatatcatgcattaacgcagcagtcaataca |
14421017 |
T |
 |
| Q |
401 |
ttggtggttgttggatcaaag |
421 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
14421018 |
ttggtggttgttggatcaaag |
14421038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University