View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9371_low_43 (Length: 285)
Name: NF9371_low_43
Description: NF9371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9371_low_43 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 20 - 215
Target Start/End: Original strand, 26838320 - 26838515
Alignment:
| Q |
20 |
taattacaaaaaagtttatgtaaaactgttagatatagttttctggctcattcataggaagtttacattttcatagtactactataggtaaattcttccc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26838320 |
taattacaaaaaagtttatgtaaaactgttagatatagttttttggctcattcataggaagtttacattttcatagtactactataggtagattcttccc |
26838419 |
T |
|
| Q |
120 |
nnnnnnnnnnnnggctctaccgaaaaatcaatgtaatcattgaagaaggttaagaaaaatgatgtgtatcgagtattctgtcagatttacccatga |
215 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26838420 |
ttttttatttttggctctaccaaaaaatcactgtaatcattgaagaaggttgagaaaaataatgtgtatcgagtattctgtcagatttacccatga |
26838515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 213 - 270
Target Start/End: Original strand, 26838558 - 26838615
Alignment:
| Q |
213 |
tgaaattaatgattcatctcttgtctttaagcaacaattgccctcctggaacatatat |
270 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26838558 |
tgaaattaatcattcttctcttgtctttaagcaacaattgccctcctggaacatatat |
26838615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University