View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9371_low_55 (Length: 238)
Name: NF9371_low_55
Description: NF9371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9371_low_55 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
| [»] scaffold0376 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 16 - 238
Target Start/End: Original strand, 38867134 - 38867356
Alignment:
| Q |
16 |
tggtgttgttccttctggtttttggggtttgcctcatgtgtatctacttgagcttgttgaaaattcactttctgggcctatttcaaatgcaatttcagga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38867134 |
tggtgttgttccttctggtttttggggtttgcctcatgtgtatctacttgagcttgttgaaaattcactttctgggcctatttcaaatgcaatttcagga |
38867233 |
T |
 |
| Q |
116 |
gcaagtaatctttcaattttgttgatttcagggaataggtttaatgggtcaattcctgattcaattgggtcattgtctaatcttggagagtttgttgcta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38867234 |
gcaagtaatctttcaattttgttgatttcagggaataggtttaatgggtcaattcctgattcaattgggtcattgtctaatcttggagagtttgttgcta |
38867333 |
T |
 |
| Q |
216 |
gcagtaatagtcttaccggtcca |
238 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
38867334 |
gcagtaatagtcttaccggtcca |
38867356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0376 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0376
Description:
Target: scaffold0376; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 36 - 160
Target Start/End: Complemental strand, 6859 - 6737
Alignment:
| Q |
36 |
tttggggtttgcctcatgtgtatctacttgagcttgttgaaaattcactttctgggcctatttcaaatgcaatttcaggagcaagtaatctttcaatttt |
135 |
Q |
| |
|
||||| |||||| ||||| | || |||||||||||| ||||| ||| || | ||| || |||||| ||| ||||| ||| |||| |||| |||||||||| |
|
|
| T |
6859 |
tttggagtttgcttcatgggcatatacttgagcttgatgaaa-ttctctgtttggtcc-atttcagatgaaattttaggtgcaaataatatttcaatttt |
6762 |
T |
 |
| Q |
136 |
gttgatttcagggaataggtttaat |
160 |
Q |
| |
|
||| | | || |||||||||||||| |
|
|
| T |
6761 |
gttaactacatggaataggtttaat |
6737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University