View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9371_low_58 (Length: 229)

Name: NF9371_low_58
Description: NF9371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9371_low_58
NF9371_low_58
[»] chr1 (1 HSPs)
chr1 (6-229)||(8317227-8317450)


Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 6 - 229
Target Start/End: Complemental strand, 8317450 - 8317227
Alignment:
6 agatttcacgtggtgaaattgctttaaaaggtgaacgagaaaaggaatgcgttctgtttcaggaaaacttggcttacaaatgatttcagctgaatcaaaa 105  Q
    |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8317450 agatttcacgcgatgaaattgctttaaaaggtgaacgagaaaaggaatgcgttctgtttcaggaaaacttggcttacaaatgatttcagctgaatcaaaa 8317351  T
106 gacaggaaaccatgatcgaacaaatgaattagttgtgctgtaccatacccagagtaagtgaattgcttgagatgcaaagcattgaatttgatggattggc 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8317350 gacaggaaaccatgatcgaacaaatgaattagttgtgctgtaccatacccagagtaagtgaattgcttgagatgcaaagcattgaatttgatggattggc 8317251  T
206 tatgtaggtcatgggatgccgcat 229  Q
    ||||||||||||||||||||||||    
8317250 tatgtaggtcatgggatgccgcat 8317227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University