View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9371_low_59 (Length: 229)
Name: NF9371_low_59
Description: NF9371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9371_low_59 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 6 - 229
Target Start/End: Complemental strand, 8317450 - 8317227
Alignment:
| Q |
6 |
agatttcacgtggtgaaattgctttaaaaggtgaacgagaaaaggaatgcgttctgtttcaggaaaacttggcttacaaatgatttcagctgaatcaaaa |
105 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8317450 |
agatttcacgcgatgaaattgctttaaaaggtgaacgagaaaaggaatgcgttctgtttcaggaaaacttggcttacaaatgatttcagctgaatcaaaa |
8317351 |
T |
|
| Q |
106 |
gacaggaaaccatgatcgaacaaatgaattagttgtgctgtaccatacccagagtaagtgaattgcttgagatgcaaagcattgaatttgatggattggc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8317350 |
gacaggaaaccatgatcgaacaaatgaattagttgtgctgtaccatacccagagtaagtgaattgcttgagatgcaaagcattgaatttgatggattggc |
8317251 |
T |
|
| Q |
206 |
tatgtaggtcatgggatgccgcat |
229 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
8317250 |
tatgtaggtcatgggatgccgcat |
8317227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University