View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9372_low_29 (Length: 256)
Name: NF9372_low_29
Description: NF9372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9372_low_29 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 17 - 249
Target Start/End: Original strand, 11600092 - 11600324
Alignment:
| Q |
17 |
cattagaaccattatagcacgacctagagagtggtctagtttgtctaaaaatatggtttcaaccacattagaaccagaagcatcatcatcactttcaatc |
116 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11600092 |
cattagaaccattatagcatgacctagagagtggtctagtttgtctaaaaatatggtttcaaccacattagaaccagaagcatcatcatcactttcaatc |
11600191 |
T |
|
| Q |
117 |
acaaaagtttataaaaatattgaagagttagaactgaagcaaaagtgagaaaacactttcagaaccatgaaagcttcagataaggtgtttctacatttga |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11600192 |
acaaaagtttataaaaatattgaagagttagaactgaagcaaaggtgagaaaacactttcagaaccatgaaagcttcagataaggtgtttctacatttga |
11600291 |
T |
|
| Q |
217 |
aattcttaagaatctcagtaagcagtttgacaa |
249 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
11600292 |
aattcctaagaatctcagtaagcagtttgacaa |
11600324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University