View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9373_low_12 (Length: 217)
Name: NF9373_low_12
Description: NF9373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9373_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 15 - 202
Target Start/End: Original strand, 34658592 - 34658778
Alignment:
| Q |
15 |
tggtggtattatgggcagtgaacgttccctacaagnnnnnnnnnccaaaatagaaatgtgaacttgagaaaatatgaacttgttaaattgtccttctcaa |
114 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34658592 |
tggtagtattatgggcagtgaacgttccctacaagtttttgtt-ccaaaatagaaatgtgaacttgagaaaatatgaacttgttaaattgtccttctcaa |
34658690 |
T |
|
| Q |
115 |
ttctcatctacctttgaataactaattacctttcaaggattggttggttcttagaatatcaataagagtacgtattattataattagt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34658691 |
ttctcatctacctttgaataactaattacctttcagggattggttggttcttagaatagcaataagagtacgtattattataattagt |
34658778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University