View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9373_low_13 (Length: 206)
Name: NF9373_low_13
Description: NF9373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9373_low_13 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 5 - 206
Target Start/End: Original strand, 33645364 - 33645564
Alignment:
| Q |
5 |
tttttaaacgttgtatgtctatgttgtgatcaaaacacaagttcgttgattaagtgtaatacatggctccatgtattgactacaatagtggctccaagag |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33645364 |
tttttaaacgttgtatgtctatgttgtgatcaaaacacaagttcgttgattaactgtaatatatggctccatgtattgactacaatagtggctccaagag |
33645463 |
T |
 |
| Q |
105 |
ctattgttaatccgatgcgatgagtattgttgtagtttatttgtactttgagttctc-nnnnnnnnggttacaataggaaaatattttgtactttgagtt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
33645464 |
ctattgttaatccgatgcgatgagtattgttgtag-ttatttgtactttgagttctcttttttttttgttacaataggaaaata-tttgtactttgagtt |
33645561 |
T |
 |
| Q |
204 |
cca |
206 |
Q |
| |
|
||| |
|
|
| T |
33645562 |
cca |
33645564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University