View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9374_low_1 (Length: 658)
Name: NF9374_low_1
Description: NF9374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9374_low_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 63; Significance: 5e-27; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 63; E-Value: 5e-27
Query Start/End: Original strand, 575 - 649
Target Start/End: Complemental strand, 1579652 - 1579578
Alignment:
| Q |
575 |
gacactttcatagccctcatacccaaggctgaccctcccaccacttacaaagactttcgccccattagcctatgc |
649 |
Q |
| |
|
|||||| | |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1579652 |
gacactcttatagccctcatacccaaggcggaccctcccaccacttacaaagactttcgccccattagcctatgc |
1579578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 4e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 594 - 649
Target Start/End: Original strand, 48847850 - 48847905
Alignment:
| Q |
594 |
tacccaaggctgaccctcccaccacttacaaagactttcgccccattagcctatgc |
649 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
48847850 |
tacccaaggccgaccctcccaccacttacaaagacttttgccccattagcctatgc |
48847905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University