View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9374_low_5 (Length: 327)
Name: NF9374_low_5
Description: NF9374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9374_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 165 - 254
Target Start/End: Original strand, 8913211 - 8913300
Alignment:
| Q |
165 |
ccattgaaagttgaagaaaaatatgtgtggannnnnnncttatctattgaggatagaacaattgaaggttttggcttacgtggatgatga |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8913211 |
ccattgaaagttgaagaaaaatatgtgtggatttttttcttatctagtgaggatagaacaattgaaggttttggcttacgtggatgatga |
8913300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 259 - 293
Target Start/End: Original strand, 8913318 - 8913352
Alignment:
| Q |
259 |
atgaagccctctctaaatacgaagaagtatccgat |
293 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
8913318 |
atgatgccctctctaaatacgaagaagtatccgat |
8913352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University