View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9375_4 (Length: 313)
Name: NF9375_4
Description: NF9375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9375_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 21 - 289
Target Start/End: Complemental strand, 8683688 - 8683420
Alignment:
| Q |
21 |
gaacctgtgaatgaatcaatgaacatataagataacaaatcaaagatttacataaaaatcgaaacaaaagacgttacagagactaacctgacagcatttc |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
8683688 |
gaacctgtgaatgaatcaatgaacatataagataacaaatcaaagatttacataaaaatcgaaacaaaagaagttacagatactaacctgacagcatttc |
8683589 |
T |
 |
| Q |
121 |
tccnnnnnnnnnnnnntccaatagccatttggaaacttgaacttatgatcaaagcaccttgaatccctctcattgtcatagtaaacctctaggaaattca |
220 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8683588 |
tccaaaaaccaaaaaatccaatagccatttggaaacttgaacttatgatcaaagcaccttgaatccctctcattgtcatagtaaacctctaggaaattca |
8683489 |
T |
 |
| Q |
221 |
aacaaacatgtagacaaagtcagcaaaatgaaaacgctaaagagtgaaacattttccatttataacatg |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8683488 |
aacaaacatgtagacaaagtcagcaaaatgaaaacgctaaagagtgaaacattttccatttataacatg |
8683420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University