View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9376_low_19 (Length: 297)
Name: NF9376_low_19
Description: NF9376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9376_low_19 |
 | |
|
| [»] chr4 (5 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 92; Significance: 1e-44; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 194 - 297
Target Start/End: Complemental strand, 26597357 - 26597254
Alignment:
| Q |
194 |
atagatatcatcatattcttgttcatttggaatgtttcttccagaaccttgagcgaacaacgtgatgattataatgttaccgataaggaaaacaaaataa |
293 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26597357 |
atagacatcatcatattcttgttcatttggaacgtttcttccagaaccttgagcgaagaacgtgatgattataatgttaccgataaggaaaacaaaataa |
26597258 |
T |
|
| Q |
294 |
tgac |
297 |
Q |
| |
|
|||| |
|
|
| T |
26597257 |
tgac |
26597254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 26597550 - 26597464
Alignment:
| Q |
1 |
tgttctcactctcacacctttgcaacacacgatgttgnnnnnnnaaattttcactctcacaccttctataactcttcttcacccctc |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26597550 |
tgttctcactctcacacctttgcaacacacgatgttgtttttttaaattttcactctcacaccttctataactcttcttcacccctc |
26597464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 198 - 292
Target Start/End: Complemental strand, 26612673 - 26612579
Alignment:
| Q |
198 |
atatcatcatattcttgttcatttggaatgtttcttccagaaccttgagcgaacaacgtgatgattataatgttaccgataaggaaaacaaaata |
292 |
Q |
| |
|
|||||||||| ||| ||||| |||||||||||| ||||| |||||||||||||| |||||||||||||||||| ||||||| || |||||||| |
|
|
| T |
26612673 |
atatcatcatgttcctgttcttttggaatgttttttccattaccttgagcgaacagcgtgatgattataatgtttccgataacaaagacaaaata |
26612579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 198 - 295
Target Start/End: Complemental strand, 26605156 - 26605059
Alignment:
| Q |
198 |
atatcatcatattcttgttcatttggaatgtttcttccagaaccttgagcgaacaacgtgatgattataatgttaccgataaggaaaacaaaataatg |
295 |
Q |
| |
|
|||||||||| ||| ||||| ||||||| ||| |||||||||| ||||| ||||||||||||||||||| ||||||||| | |||||||||||||| |
|
|
| T |
26605156 |
atatcatcatgttcatgttcttttggaacattttttccagaaccctgagcaaacaacgtgatgattataacgttaccgattacaaaaacaaaataatg |
26605059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 55 - 83
Target Start/End: Complemental strand, 26605299 - 26605271
Alignment:
| Q |
55 |
tctcacaccttctataactcttcttcacc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
26605299 |
tctcacaccttctataactcttcttcacc |
26605271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University