View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9377_low_19 (Length: 352)
Name: NF9377_low_19
Description: NF9377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9377_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 44310193 - 44309978
Alignment:
| Q |
1 |
gtatcatattcctacacaaaatataaacttttagtttattaataatagattgaattttgattgccatgctttgatgttataggtttcctatagctgaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44310193 |
gtatcatattcctacacaaaatataaacttttagtttattaataatagattgaattttgattgccatgctttgatgttataggtttcctatagctgaaca |
44310094 |
T |
|
| Q |
101 |
------------------attatgtcaatctctttcacaatggactggtggtagttcatagtatgcatctcaagacaaggtttttggaaagctattatga |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44310093 |
tactgagaaaccaacacaattatgtcaatctctttcacaatggactggtggtagttcatagtatgcatctcaagacaaggtttttggaaagctattatga |
44309994 |
T |
|
| Q |
183 |
gaagttggaccttttt |
198 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
44309993 |
gaagttggaccttttt |
44309978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 195 - 333
Target Start/End: Complemental strand, 44309539 - 44309401
Alignment:
| Q |
195 |
ttttgttgaaattcattttaactcaaccctcctcttcaaacatatctgcaaccaatttttccttatccaatgcaacatcaaaaagtctactaaattgatg |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44309539 |
ttttgttgaaattcattttaactcaaccctcctcttcaaacatatctgcaaccaatttttccttatccaatgcaacatcaaaaagtctactaaattgatg |
44309440 |
T |
|
| Q |
295 |
acgcaaaatgcatatctattaatgacgaaaaatgttgca |
333 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44309439 |
acgcaaaatgtatatctattaatgacgaaaaatgttgca |
44309401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 133; Significance: 4e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 153 - 346
Target Start/End: Complemental strand, 18701354 - 18701145
Alignment:
| Q |
153 |
caagacaaggtttttggaaagctattatgagaagttggacctttttgtt----------------gaaattcattttaactcaaccctcctcttcaaaca |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
18701354 |
caagacaaggtttttggaaagctattatgagaagttggacctttttattttatttactgtctattgaaattcattttaactcaaccctcctcttcaaaca |
18701255 |
T |
|
| Q |
237 |
tatctgcaaccaatttttccttatccaatgcaacatcaaaaagtctactaaattgatgacgcaaaatgcatatctattaatgacgaaaaatgttgcaggg |
336 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
18701254 |
tatctgcaaccaatttttacttatccaacgcaacatcaaaaagtctactaaattgatgacacaaaatgtatatctattaatgacgaaaaatgttccaggg |
18701155 |
T |
|
| Q |
337 |
cctttgcttc |
346 |
Q |
| |
|
|||||||||| |
|
|
| T |
18701154 |
cctttgcttc |
18701145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University