View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9377_low_22 (Length: 322)
Name: NF9377_low_22
Description: NF9377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9377_low_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 2 - 308
Target Start/End: Complemental strand, 6015756 - 6015450
Alignment:
| Q |
2 |
atattaccagtaatctttacaggaacatgaaccaccactaaaatggtggaaccgactacgatccctgataacaatctctctagcgtaaaccttggatatg |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6015756 |
atattaccagtaatctttacaggaacatgaaccaccactaaaatggtggaaccgactacgatccctgataataatctctctagcgtaaaccttggatatg |
6015657 |
T |
|
| Q |
102 |
agtttgatagccatatgacaatccgcacaaactcttaaattctttatgaccctgattggagtccctggtgctgtattcaagagcataaaagcaattgcaa |
201 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6015656 |
agtttgatagccatatgacaatcggcacaaactcttaaattctttatgaccctgattggagtccctggtgctgtattcaagagcataaaagcaattgcaa |
6015557 |
T |
|
| Q |
202 |
ctttttcactatgataagacagggcttgttccttttcctcttcctctatatctgcaagcacatttgctgtatgaggcacataaccttctaacttcaacaa |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6015556 |
ctttttcactatgataagacagggcttgttccttttcctcttcctctatatctgcaagcacatttgctgtatgaggcacataaccttctaacttcaacaa |
6015457 |
T |
|
| Q |
302 |
ttctgtg |
308 |
Q |
| |
|
||||||| |
|
|
| T |
6015456 |
ttctgtg |
6015450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University