View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9377_low_29 (Length: 279)
Name: NF9377_low_29
Description: NF9377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9377_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 48317550 - 48317289
Alignment:
| Q |
1 |
ggctgcctcagatcaaacacttgtttgtgtgaaacaagtgaagcaagaggtagctgatgaatgggatgagagcatgccattaccaggagacatcattgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48317550 |
ggctgcctcagatcaaacacttgtttgtgtgaaacaagtgaagcaagaggtagctgatgaatgggatgagagcatgccattaccaggagacatccttgaa |
48317451 |
T |
 |
| Q |
101 |
ggattctctgaacatgatgtcgacgacgctgatgaatcctttgtatcggtcaagaccaattctgagtttagttctcagcttggcaagatcaaccaacgtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48317450 |
ggattctctgaacatgatgtcgacgacgctgataaatcctttgtatcggtcaagaccaattctgagtttagttctcagcttggcaagatcaaccgacgtg |
48317351 |
T |
 |
| Q |
201 |
tggagtctatatggatacaggttagaagaggcgatggtttgctgaaactgcagacatgtatc |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48317350 |
tggagtctatatggatacaggttagaagaggcgatggtttgctgaaactgcagacatgtatc |
48317289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University