View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9377_low_51 (Length: 214)
Name: NF9377_low_51
Description: NF9377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9377_low_51 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 12 - 198
Target Start/End: Complemental strand, 15694810 - 15694624
Alignment:
| Q |
12 |
aagcaaaggttataactacaccagcataggcgaaaacacaacaaaaggagatgcagtgtatggtctctatgattgtcgtggcgatataagcttttgtgaa |
111 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15694810 |
aagcaaaggttataactacaacagcataggcgaaaacacaacaaaaggagatgcagtgtatggtctctatgattgtcgtggcgatgtaagcttttgtgaa |
15694711 |
T |
|
| Q |
112 |
ttatgtgtcgcttctgctactagaaaagttcttgagcgctgccccaatagagtcgccgctactatattctacagtgactgcattttg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
15694710 |
ttatgtgtcgcttctgctactagaaaagttcttgagcgctgccccaatagagtcgccgctactatattttacagcgactgcattttg |
15694624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University