View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9377_low_52 (Length: 212)
Name: NF9377_low_52
Description: NF9377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9377_low_52 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 18 - 180
Target Start/End: Complemental strand, 28749756 - 28749594
Alignment:
| Q |
18 |
aatggagctttcggaagctgctgaaattagtcaaaaattgtgttcaatgcatcaagataccagaggaaatgtggaacatgcttaccagtgttctccaaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28749756 |
aatggagctttcggaagctgctgaaattagtcaaaaattgtgttcaatgcatcaagataccagaggaaatgtggaacatgcttaccagtgttctccaaca |
28749657 |
T |
|
| Q |
118 |
gctctcactattaagtttacaaacttcgattccattcgttcaacaacgtttcttaacagtatt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28749656 |
gctctcactattaagtttacaaacttcgattccattcgttcaacaacgtttcttaacaatatt |
28749594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University