View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9378_high_2 (Length: 238)

Name: NF9378_high_2
Description: NF9378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9378_high_2
NF9378_high_2
[»] chr3 (1 HSPs)
chr3 (20-214)||(49444445-49444643)


Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 20 - 214
Target Start/End: Complemental strand, 49444643 - 49444445
Alignment:
20 tactgctccacaaaatgcaatagatgcatgatcttttactctttttgcaatggaagtttgtaatctttgatccacttgatagagaaatttaatacccagg 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49444643 tactgctccacaaaatgcaatagatgcatgatcttttactctttttgcaatggaagtttgtaatctttgatccacttgatagagaaatttaatacccagg 49444544  T
120 cataaggtaagcccaggccacgccacgccacgccacgccaagcc----gatgtgtctgtttaaagggtctaatatcccaagagataaggccatggtatt 214  Q
    ||||||||||||||| |||| |||||||||||||||||||||||    ||||||||||||||||||||||||||||||||||| |||||||||||||||    
49444543 cataaggtaagcccatgccatgccacgccacgccacgccaagccacatgatgtgtctgtttaaagggtctaatatcccaagaggtaaggccatggtatt 49444445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University