View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9378_high_2 (Length: 238)
Name: NF9378_high_2
Description: NF9378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9378_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 20 - 214
Target Start/End: Complemental strand, 49444643 - 49444445
Alignment:
| Q |
20 |
tactgctccacaaaatgcaatagatgcatgatcttttactctttttgcaatggaagtttgtaatctttgatccacttgatagagaaatttaatacccagg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49444643 |
tactgctccacaaaatgcaatagatgcatgatcttttactctttttgcaatggaagtttgtaatctttgatccacttgatagagaaatttaatacccagg |
49444544 |
T |
 |
| Q |
120 |
cataaggtaagcccaggccacgccacgccacgccacgccaagcc----gatgtgtctgtttaaagggtctaatatcccaagagataaggccatggtatt |
214 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
49444543 |
cataaggtaagcccatgccatgccacgccacgccacgccaagccacatgatgtgtctgtttaaagggtctaatatcccaagaggtaaggccatggtatt |
49444445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University