View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9378_low_1 (Length: 393)
Name: NF9378_low_1
Description: NF9378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9378_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 343; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 11 - 373
Target Start/End: Complemental strand, 9791638 - 9791276
Alignment:
| Q |
11 |
gattatacttttgggattttgatgaagggactttgtttaacgaataggattggtgaaggttttaagcttttgcagcttattaagaataacggggttacac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9791638 |
gattatacttttgggattttgatgaagggactttgtttaacgaataggattggtgaaggttttaagcttttgcagcttattaagaataacggggttacac |
9791539 |
T |
 |
| Q |
111 |
ccaatactgttatttataatactttgcttcatgcactttgtaggaatggaaaaattggtagggctaggagcttgatgaatgagatggtggacccgaatga |
210 |
Q |
| |
|
| |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9791538 |
caaatactgttatttacaatactttgcttcatgcactttgtaggaatggaaaagttggtagggctaggagcttgatgaatgagatggtggacccgaatga |
9791439 |
T |
 |
| Q |
211 |
ggttacgtttaatattttgatatcttcttattgtaaggaagagaatttagtccaagctcttgttttgcttgagaagtgttttgcattgagtcttgtacct |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9791438 |
ggttacgtttaatattttgatatcttcttattataaggaagagaatttagtccaagctcttgttttgcttgagaagtgctttgcattgagtcttgtacct |
9791339 |
T |
 |
| Q |
311 |
gatgttgttaccgtgactaaggtggttgagattctatgcaatgctggccgtgtaacggaggct |
373 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9791338 |
gatgttgttaccgtgactaaggtggttgagattctatgcaatgctggccgtgtaacggaggct |
9791276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University