View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9378_low_3 (Length: 301)
Name: NF9378_low_3
Description: NF9378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9378_low_3 |
 |  |
|
| [»] scaffold0032 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0032 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: scaffold0032
Description:
Target: scaffold0032; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 25 - 284
Target Start/End: Complemental strand, 41242 - 40983
Alignment:
| Q |
25 |
cagacagatctgagagtgcaggaaggatgtgtgatcccctgataattatagggttgatgatatagcattatttccatgaatgatgaattctgaaaacaaa |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41242 |
cagacagatctgagagtgcaggaaggatgtgtgatcccctgataattatagggttgatgatatagcattatttccatgaatgatgaattctgaaaacaaa |
41143 |
T |
 |
| Q |
125 |
ggttgcaaattgttgtggtatacatgaatagcaatgaaatgcagaaatggcaactccctttgcaaaaacttaattaaacactatgctttaaatagcaata |
224 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41142 |
ggttgcaaattgttgtgttatacatgaatagcaatgaaatgcagaaatggcaactccctttacaaaaacttaattaaacactatgctttaaatagcaata |
41043 |
T |
 |
| Q |
225 |
tggatcaaatagcaatctaagttaaatttggactctctaactaaaagccaactatgttaa |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41042 |
tggatcaaatagcaatctaagttaaatttggactctctaactaaaagccaactatgttaa |
40983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University