View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9378_low_4 (Length: 245)

Name: NF9378_low_4
Description: NF9378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9378_low_4
NF9378_low_4
[»] chr4 (146 HSPs)
chr4 (108-236)||(4360634-4360762)
chr4 (108-184)||(50362129-50362207)
chr4 (5-87)||(20964423-20964505)
chr4 (108-184)||(7230273-7230351)
chr4 (5-87)||(28330688-28330770)
chr4 (5-82)||(36047230-36047308)
chr4 (5-87)||(53848229-53848310)
chr4 (119-183)||(20799395-20799461)
chr4 (108-183)||(12322667-12322744)
chr4 (108-183)||(19588148-19588225)
chr4 (108-183)||(23809943-23810020)
chr4 (108-169)||(21318243-21318304)
chr4 (108-186)||(24664981-24665061)
chr4 (1-87)||(44633052-44633138)
chr4 (1-87)||(4360533-4360618)
chr4 (108-184)||(11949753-11949831)
chr4 (108-184)||(23304006-23304084)
chr4 (108-184)||(38453258-38453336)
chr4 (1-87)||(47386611-47386697)
chr4 (108-183)||(9946421-9946498)
chr4 (124-170)||(53190304-53190350)
chr4 (108-170)||(56551582-56551644)
chr4 (109-170)||(16304089-16304150)
chr4 (6-87)||(21954833-21954915)
chr4 (5-87)||(38319807-38319889)
chr4 (108-169)||(47490697-47490758)
chr4 (5-87)||(49218912-49218988)
chr4 (111-184)||(10303504-10303579)
chr4 (119-167)||(23775530-23775578)
chr4 (47-87)||(25390612-25390652)
chr4 (47-87)||(48740417-48740457)
chr4 (108-152)||(49041971-49042015)
chr4 (5-82)||(54217243-54217320)
chr4 (108-187)||(2888863-2888945)
chr4 (108-184)||(8494980-8495058)
chr4 (119-170)||(20383497-20383548)
chr4 (119-183)||(44815935-44816001)
chr4 (109-167)||(281603-281661)
chr4 (111-169)||(2434451-2434509)
chr4 (108-170)||(3936636-3936698)
chr4 (109-184)||(6087740-6087817)
chr4 (108-170)||(8027387-8027449)
chr4 (108-150)||(11198357-11198399)
chr4 (44-78)||(18509747-18509781)
chr4 (108-170)||(19854574-19854636)
chr4 (108-170)||(21317328-21317390)
chr4 (108-170)||(28435238-28435300)
chr4 (1-60)||(29550852-29550911)
chr4 (108-183)||(35287497-35287574)
chr4 (108-166)||(38374970-38375028)
chr4 (108-183)||(43034332-43034409)
chr4 (132-170)||(50442761-50442799)
chr4 (111-169)||(56204957-56205014)
chr4 (111-152)||(10148206-10148247)
chr4 (120-169)||(17423179-17423228)
chr4 (119-152)||(18094432-18094465)
chr4 (132-169)||(20096284-20096321)
chr4 (120-165)||(25783451-25783496)
chr4 (116-169)||(29908066-29908119)
chr4 (109-170)||(32006509-32006570)
chr4 (1-87)||(42024326-42024412)
chr4 (38-87)||(42132709-42132758)
chr4 (42-87)||(46958617-46958662)
chr4 (47-87)||(9093904-9093944)
chr4 (117-169)||(14197430-14197482)
chr4 (108-152)||(21449889-21449932)
chr4 (112-168)||(21623413-21623469)
chr4 (108-152)||(34042267-34042311)
chr4 (47-87)||(39053073-39053113)
chr4 (47-87)||(39258447-39258487)
chr4 (47-87)||(41594875-41594915)
chr4 (47-87)||(42670552-42670592)
chr4 (111-184)||(47814244-47814319)
chr4 (119-184)||(49473638-49473705)
chr4 (108-152)||(54294412-54294456)
chr4 (108-152)||(54857605-54857649)
chr4 (119-170)||(675927-675978)
chr4 (132-184)||(2186347-2186401)
chr4 (131-170)||(2649746-2649785)
chr4 (108-184)||(16470297-16470375)
chr4 (108-184)||(17728075-17728153)
chr4 (109-152)||(19479468-19479511)
chr4 (108-143)||(29240213-29240248)
chr4 (5-73)||(35029226-35029294)
chr4 (120-184)||(36035827-36035893)
chr4 (119-183)||(39171371-39171437)
chr4 (132-184)||(52270044-52270098)
chr4 (120-180)||(54500566-54500628)
chr4 (49-87)||(283650-283688)
chr4 (120-170)||(836237-836287)
chr4 (108-170)||(2034085-2034147)
chr4 (108-170)||(2587691-2587752)
chr4 (108-170)||(5924658-5924720)
chr4 (108-183)||(10261759-10261835)
chr4 (132-183)||(13121538-13121591)
chr4 (112-170)||(14577501-14577559)
chr4 (108-170)||(16431625-16431687)
chr4 (108-183)||(21562620-21562696)
chr4 (120-170)||(23160049-23160099)
chr4 (108-183)||(23247588-23247665)
chr4 (119-169)||(25115059-25115109)
chr4 (108-183)||(26926700-26926776)
chr4 (1-60)||(28279760-28279819)
chr4 (128-170)||(34247449-34247491)
chr4 (41-87)||(37316087-37316133)
chr4 (108-170)||(37921755-37921817)
chr4 (49-87)||(39976564-39976602)
chr4 (47-77)||(41203610-41203640)
chr4 (108-183)||(43330141-43330217)
chr4 (119-169)||(43722775-43722825)
chr4 (124-170)||(46676504-46676550)
chr4 (108-183)||(51450207-51450283)
chr4 (38-87)||(8759676-8759725)
chr4 (108-149)||(8760266-8760307)
chr4 (108-149)||(10035295-10035336)
chr4 (108-169)||(19908702-19908763)
chr4 (111-148)||(20566735-20566771)
chr4 (108-165)||(21114295-21114352)
chr4 (119-152)||(30850385-30850418)
chr4 (5-79)||(34020939-34021013)
chr4 (131-185)||(36203228-36203284)
chr4 (120-182)||(37193244-37193308)
chr4 (133-170)||(38416066-38416103)
chr4 (120-169)||(41520964-41521013)
chr4 (109-170)||(43782296-43782357)
chr4 (108-169)||(44909834-44909895)
chr4 (115-152)||(49953400-49953437)
chr4 (47-87)||(1825421-1825461)
chr4 (108-184)||(6586136-6586211)
chr4 (47-87)||(8294921-8294961)
chr4 (108-152)||(9196240-9196284)
chr4 (108-152)||(9783926-9783970)
chr4 (110-170)||(13264272-13264332)
chr4 (131-184)||(13276122-13276177)
chr4 (47-87)||(13529758-13529798)
chr4 (119-184)||(14202480-14202547)
chr4 (109-169)||(22630351-22630411)
chr4 (39-75)||(33093613-33093649)
chr4 (47-87)||(35998289-35998329)
chr4 (108-152)||(39974529-39974573)
chr4 (39-87)||(41436377-41436425)
chr4 (47-87)||(42051829-42051869)
chr4 (47-87)||(43420921-43420961)
chr4 (119-151)||(48694651-48694683)
chr4 (108-152)||(49385296-49385340)
chr4 (113-153)||(50152233-50152273)
[»] chr8 (106 HSPs)
chr8 (5-87)||(14689856-14689938)
chr8 (3-87)||(2195364-2195448)
chr8 (5-87)||(2796935-2797017)
chr8 (108-164)||(8881290-8881346)
chr8 (108-183)||(27587215-27587292)
chr8 (5-87)||(8394647-8394729)
chr8 (109-170)||(8717466-8717527)
chr8 (38-87)||(10729083-10729131)
chr8 (38-87)||(38252600-38252649)
chr8 (119-185)||(39821876-39821944)
chr8 (108-167)||(12748913-12748972)
chr8 (108-170)||(6235541-6235603)
chr8 (108-183)||(13357431-13357508)
chr8 (108-183)||(19163526-19163603)
chr8 (41-87)||(29451244-29451290)
chr8 (108-170)||(32051522-32051584)
chr8 (125-184)||(33451356-33451417)
chr8 (120-169)||(7553689-7553738)
chr8 (109-183)||(11708980-11709056)
chr8 (108-182)||(17704008-17704084)
chr8 (5-87)||(45421069-45421151)
chr8 (108-184)||(8999881-8999960)
chr8 (109-169)||(13449788-13449848)
chr8 (39-87)||(15020569-15020617)
chr8 (47-87)||(32967448-32967488)
chr8 (5-84)||(8566535-8566615)
chr8 (108-184)||(13575282-13575360)
chr8 (1-61)||(14117384-14117444)
chr8 (119-170)||(18942927-18942978)
chr8 (116-184)||(27750902-27750972)
chr8 (109-152)||(29652245-29652288)
chr8 (108-183)||(37999409-37999487)
chr8 (115-170)||(42208466-42208521)
chr8 (109-152)||(44084263-44084305)
chr8 (108-170)||(444422-444484)
chr8 (41-87)||(2875251-2875297)
chr8 (108-170)||(5179802-5179864)
chr8 (112-166)||(10871888-10871942)
chr8 (108-170)||(24838160-24838222)
chr8 (108-170)||(25136834-25136896)
chr8 (110-152)||(44794920-44794962)
chr8 (108-169)||(6447199-6447260)
chr8 (110-184)||(13286124-13286199)
chr8 (129-170)||(29908020-29908061)
chr8 (117-170)||(30427740-30427792)
chr8 (119-168)||(31336808-31336857)
chr8 (5-87)||(32231849-32231930)
chr8 (38-87)||(37459246-37459295)
chr8 (121-169)||(989580-989628)
chr8 (39-87)||(1494409-1494457)
chr8 (108-168)||(12800890-12800950)
chr8 (117-169)||(13105104-13105156)
chr8 (108-152)||(15001265-15001309)
chr8 (108-152)||(19260569-19260613)
chr8 (135-184)||(23816783-23816834)
chr8 (108-152)||(26932753-26932797)
chr8 (119-184)||(29499764-29499831)
chr8 (47-83)||(29615695-29615731)
chr8 (108-152)||(30176409-30176453)
chr8 (108-152)||(36122550-36122594)
chr8 (108-168)||(37141368-37141428)
chr8 (108-148)||(40679719-40679759)
chr8 (47-87)||(44790593-44790633)
chr8 (108-184)||(7996933-7997011)
chr8 (5-73)||(17790226-17790294)
chr8 (124-184)||(19778058-19778120)
chr8 (53-87)||(12653581-12653615)
chr8 (41-87)||(14748872-14748918)
chr8 (108-183)||(20665353-20665429)
chr8 (108-183)||(22775622-22775699)
chr8 (120-183)||(27718896-27718961)
chr8 (108-183)||(30550716-30550792)
chr8 (108-170)||(33743584-33743646)
chr8 (121-184)||(37938488-37938553)
chr8 (120-170)||(40919362-40919411)
chr8 (108-183)||(44215465-44215541)
chr8 (108-169)||(498741-498802)
chr8 (108-169)||(3650530-3650591)
chr8 (38-83)||(8618029-8618074)
chr8 (120-169)||(12160431-12160480)
chr8 (121-170)||(12714373-12714422)
chr8 (119-152)||(33105418-33105451)
chr8 (121-166)||(33482152-33482197)
chr8 (5-83)||(33743675-33743753)
chr8 (133-183)||(37015851-37015903)
chr8 (108-169)||(40167332-40167393)
chr8 (5-75)||(43845013-43845083)
chr8 (47-87)||(138930-138970)
chr8 (55-87)||(2119612-2119644)
chr8 (108-152)||(2489707-2489751)
chr8 (108-152)||(6471538-6471582)
chr8 (108-168)||(7968931-7968990)
chr8 (40-80)||(12958345-12958385)
chr8 (112-152)||(13124357-13124397)
chr8 (108-168)||(15020772-15020832)
chr8 (133-169)||(15079167-15079203)
chr8 (131-184)||(23852904-23852959)
chr8 (119-184)||(24023416-24023483)
chr8 (108-168)||(24023698-24023758)
chr8 (121-153)||(26773805-26773837)
chr8 (109-169)||(26799194-26799254)
chr8 (109-169)||(29716691-29716751)
chr8 (109-169)||(32421579-32421638)
chr8 (47-87)||(33191087-33191127)
chr8 (108-185)||(42200652-42200731)
chr8 (47-87)||(44615537-44615577)
[»] chr3 (120 HSPs)
chr3 (3-87)||(39329877-39329961)
chr3 (108-183)||(18870715-18870792)
chr3 (5-87)||(30261631-30261713)
chr3 (108-170)||(3755348-3755410)
chr3 (39-87)||(9218041-9218089)
chr3 (108-184)||(10498685-10498763)
chr3 (119-169)||(552184-552234)
chr3 (41-87)||(38600970-38601016)
chr3 (108-170)||(45431957-45432019)
chr3 (38-87)||(1922991-1923040)
chr3 (108-182)||(25340914-25340990)
chr3 (108-169)||(38130949-38131010)
chr3 (3-84)||(42547233-42547315)
chr3 (5-87)||(46194335-46194417)
chr3 (121-183)||(48315027-48315091)
chr3 (108-169)||(51882190-51882251)
chr3 (1-87)||(53754190-53754276)
chr3 (47-87)||(1334946-1334986)
chr3 (108-171)||(8136622-8136685)
chr3 (108-184)||(16792964-16793042)
chr3 (108-180)||(27185474-27185548)
chr3 (112-184)||(43777051-43777124)
chr3 (1-85)||(48409482-48409566)
chr3 (114-168)||(759590-759644)
chr3 (119-186)||(1149070-1149139)
chr3 (108-183)||(7464481-7464558)
chr3 (119-169)||(16663237-16663287)
chr3 (108-170)||(25441490-25441552)
chr3 (109-184)||(34899090-34899167)
chr3 (108-170)||(35863803-35863865)
chr3 (108-186)||(32843252-32843332)
chr3 (38-87)||(47496073-47496122)
chr3 (108-152)||(913590-913634)
chr3 (108-152)||(48849753-48849797)
chr3 (108-184)||(7557524-7557602)
chr3 (108-184)||(10926462-10926540)
chr3 (119-174)||(27065733-27065788)
chr3 (111-170)||(38034802-38034861)
chr3 (108-166)||(10102812-10102870)
chr3 (108-166)||(10213735-10213793)
chr3 (119-169)||(10922309-10922359)
chr3 (121-184)||(16980357-16980422)
chr3 (108-170)||(29631195-29631257)
chr3 (108-150)||(35210121-35210163)
chr3 (8-87)||(39143658-39143737)
chr3 (119-186)||(44579627-44579696)
chr3 (108-170)||(55066590-55066652)
chr3 (108-169)||(4601854-4601915)
chr3 (115-152)||(5428433-5428470)
chr3 (122-184)||(7738662-7738726)
chr3 (108-152)||(39100073-39100118)
chr3 (38-83)||(41286947-41286991)
chr3 (5-87)||(45746261-45746343)
chr3 (120-169)||(46903918-46903967)
chr3 (109-170)||(52119385-52119446)
chr3 (108-169)||(54243395-54243456)
chr3 (108-152)||(334837-334881)
chr3 (108-152)||(2453840-2453884)
chr3 (47-87)||(32023271-32023311)
chr3 (121-169)||(35126272-35126320)
chr3 (108-152)||(38602985-38603029)
chr3 (47-87)||(43640742-43640782)
chr3 (108-184)||(44582717-44582796)
chr3 (112-152)||(48656893-48656933)
chr3 (47-87)||(51164845-51164885)
chr3 (108-184)||(3100214-3100292)
chr3 (120-184)||(4332669-4332735)
chr3 (109-168)||(10594688-10594747)
chr3 (108-180)||(14827522-14827596)
chr3 (119-170)||(17218500-17218551)
chr3 (47-82)||(21296680-21296715)
chr3 (108-184)||(21331407-21331485)
chr3 (120-184)||(21628890-21628956)
chr3 (48-87)||(24619086-24619125)
chr3 (108-184)||(32629073-32629151)
chr3 (108-184)||(36483669-36483747)
chr3 (131-170)||(48511259-48511298)
chr3 (47-82)||(48744126-48744161)
chr3 (40-87)||(50150531-50150578)
chr3 (124-184)||(53633623-53633685)
chr3 (108-184)||(53996292-53996370)
chr3 (108-183)||(916434-916510)
chr3 (108-170)||(11358243-11358305)
chr3 (109-159)||(21567678-21567728)
chr3 (49-87)||(36097829-36097867)
chr3 (119-169)||(41817509-41817559)
chr3 (108-183)||(48796208-48796285)
chr3 (121-170)||(977944-977993)
chr3 (108-169)||(3176964-3177024)
chr3 (42-87)||(17777146-17777191)
chr3 (42-87)||(19078447-19078492)
chr3 (111-152)||(20018224-20018265)
chr3 (108-169)||(20079732-20079793)
chr3 (108-186)||(22722393-22722473)
chr3 (112-186)||(27999691-27999767)
chr3 (108-169)||(32909291-32909352)
chr3 (119-185)||(35191818-35191886)
chr3 (111-152)||(35347288-35347329)
chr3 (121-170)||(36431818-36431867)
chr3 (38-87)||(39365179-39365228)
chr3 (108-169)||(40520762-40520823)
chr3 (111-152)||(42886502-42886543)
chr3 (109-170)||(45885468-45885529)
chr3 (108-168)||(1456530-1456590)
chr3 (108-168)||(1743980-1744040)
chr3 (110-170)||(2445522-2445582)
chr3 (108-152)||(4825366-4825410)
chr3 (135-184)||(7974529-7974580)
chr3 (108-152)||(8075812-8075856)
chr3 (108-152)||(8238591-8238635)
chr3 (118-170)||(11250597-11250649)
chr3 (116-148)||(17476745-17476777)
chr3 (108-152)||(22251450-22251494)
chr3 (108-185)||(22799716-22799795)
chr3 (108-152)||(25727957-25728001)
chr3 (124-168)||(28266727-28266771)
chr3 (108-148)||(32651675-32651715)
chr3 (108-152)||(44075146-44075190)
chr3 (47-87)||(44233986-44234026)
chr3 (119-184)||(52904144-52904211)
[»] chr2 (132 HSPs)
chr2 (108-183)||(10735821-10735898)
chr2 (5-87)||(13221965-13222046)
chr2 (108-183)||(35820291-35820368)
chr2 (5-87)||(314331-314413)
chr2 (5-87)||(5425753-5425835)
chr2 (109-170)||(30089058-30089119)
chr2 (109-170)||(30125662-30125723)
chr2 (5-87)||(31348407-31348489)
chr2 (5-75)||(31592459-31592529)
chr2 (3-81)||(44260476-44260554)
chr2 (39-81)||(2427259-2427301)
chr2 (108-170)||(24592836-24592898)
chr2 (108-170)||(29544636-29544698)
chr2 (38-87)||(6685831-6685880)
chr2 (46-87)||(20696951-20696992)
chr2 (108-169)||(31815877-31815938)
chr2 (108-152)||(20200732-20200776)
chr2 (119-180)||(20565076-20565139)
chr2 (119-184)||(31543005-31543072)
chr2 (121-184)||(27244650-27244715)
chr2 (108-170)||(30243259-30243321)
chr2 (109-166)||(660813-660870)
chr2 (5-87)||(7213371-7213453)
chr2 (1-75)||(9472330-9472404)
chr2 (108-169)||(23250310-23250371)
chr2 (1-87)||(24356007-24356093)
chr2 (109-183)||(44526122-44526198)
chr2 (119-184)||(346125-346192)
chr2 (47-87)||(3123540-3123580)
chr2 (39-87)||(6075392-6075440)
chr2 (47-87)||(7649025-7649065)
chr2 (47-87)||(25604249-25604289)
chr2 (108-152)||(27848185-27848229)
chr2 (47-87)||(28108553-28108593)
chr2 (108-152)||(36359341-36359385)
chr2 (112-184)||(7206118-7206192)
chr2 (108-147)||(7645704-7645743)
chr2 (119-170)||(11560507-11560558)
chr2 (108-184)||(20455884-20455962)
chr2 (119-170)||(25598563-25598614)
chr2 (108-184)||(27411085-27411163)
chr2 (48-87)||(40964949-40964988)
chr2 (108-184)||(42066705-42066783)
chr2 (112-183)||(1861803-1861876)
chr2 (108-183)||(2256965-2257042)
chr2 (112-170)||(4927443-4927501)
chr2 (119-169)||(5168580-5168630)
chr2 (108-170)||(25186232-25186294)
chr2 (119-169)||(27152363-27152413)
chr2 (112-170)||(30978371-30978429)
chr2 (108-170)||(31476980-31477042)
chr2 (38-87)||(6972706-6972755)
chr2 (117-170)||(12124554-12124607)
chr2 (5-87)||(28572107-28572189)
chr2 (50-87)||(30757741-30757778)
chr2 (109-183)||(34977198-34977274)
chr2 (119-152)||(37852037-37852070)
chr2 (1-83)||(38282550-38282632)
chr2 (111-152)||(42791322-42791363)
chr2 (47-87)||(3100295-3100335)
chr2 (108-152)||(4509564-4509608)
chr2 (1-78)||(18460393-18460470)
chr2 (108-185)||(20017046-20017125)
chr2 (120-152)||(24579670-24579702)
chr2 (108-148)||(31813009-31813049)
chr2 (120-152)||(32458329-32458361)
chr2 (47-87)||(40710469-40710509)
chr2 (109-169)||(41859862-41859922)
chr2 (119-170)||(8781651-8781702)
chr2 (108-184)||(10723932-10724010)
chr2 (108-170)||(19976162-19976225)
chr2 (108-184)||(21482509-21482587)
chr2 (108-184)||(22523002-22523080)
chr2 (119-170)||(24593385-24593436)
chr2 (120-180)||(29599936-29599998)
chr2 (108-184)||(33063979-33064057)
chr2 (112-184)||(41763872-41763946)
chr2 (108-184)||(45032686-45032764)
chr2 (112-170)||(833063-833121)
chr2 (119-169)||(961113-961163)
chr2 (133-184)||(3197094-3197147)
chr2 (108-183)||(3708688-3708764)
chr2 (111-169)||(8091151-8091209)
chr2 (108-183)||(11868652-11868728)
chr2 (108-170)||(13000694-13000756)
chr2 (108-170)||(20120711-20120773)
chr2 (108-170)||(30045462-30045524)
chr2 (108-170)||(30050625-30050687)
chr2 (108-170)||(30141669-30141731)
chr2 (108-183)||(35360045-35360121)
chr2 (124-170)||(35685067-35685113)
chr2 (108-170)||(36474771-36474833)
chr2 (108-169)||(42778629-42778688)
chr2 (109-170)||(3617101-3617162)
chr2 (119-164)||(4180712-4180757)
chr2 (108-169)||(4897553-4897614)
chr2 (108-169)||(4944947-4945008)
chr2 (124-169)||(6141230-6141275)
chr2 (116-169)||(6723075-6723128)
chr2 (121-170)||(7350555-7350604)
chr2 (108-153)||(8728845-8728890)
chr2 (133-183)||(9383224-9383276)
chr2 (133-183)||(9842217-9842269)
chr2 (117-170)||(12124693-12124746)
chr2 (129-170)||(12231886-12231927)
chr2 (124-169)||(14364064-14364109)
chr2 (109-183)||(14463737-14463812)
chr2 (5-87)||(18181343-18181425)
chr2 (119-152)||(18693663-18693696)
chr2 (111-152)||(22709112-22709153)
chr2 (108-169)||(25395432-25395493)
chr2 (1-83)||(28843957-28844039)
chr2 (108-169)||(29809336-29809397)
chr2 (108-149)||(29872162-29872203)
chr2 (43-80)||(29938101-29938138)
chr2 (111-184)||(32063580-32063656)
chr2 (119-152)||(38904088-38904121)
chr2 (108-149)||(44810735-44810776)
chr2 (110-170)||(1844829-1844889)
chr2 (108-184)||(7052766-7052845)
chr2 (41-85)||(12872898-12872942)
chr2 (108-152)||(15447704-15447748)
chr2 (108-152)||(16390630-16390674)
chr2 (108-152)||(20990894-20990938)
chr2 (108-152)||(21497694-21497738)
chr2 (108-152)||(22571855-22571899)
chr2 (108-168)||(26999121-26999181)
chr2 (108-152)||(32204571-32204615)
chr2 (108-164)||(36264469-36264525)
chr2 (133-182)||(41939123-41939174)
chr2 (5-77)||(43427492-43427565)
chr2 (47-87)||(44534657-44534697)
[»] chr7 (102 HSPs)
chr7 (1-87)||(37496522-37496608)
chr7 (3-87)||(34064111-34064195)
chr7 (5-87)||(32775878-32775960)
chr7 (108-169)||(21322185-21322246)
chr7 (108-184)||(19416507-19416585)
chr7 (108-184)||(27462426-27462504)
chr7 (108-170)||(3830077-3830139)
chr7 (108-183)||(10244721-10244797)
chr7 (108-170)||(16537526-16537588)
chr7 (108-170)||(16577850-16577912)
chr7 (108-170)||(16587750-16587812)
chr7 (108-170)||(16628074-16628136)
chr7 (5-87)||(5068427-5068509)
chr7 (39-87)||(32346409-32346457)
chr7 (3-87)||(3668004-3668088)
chr7 (108-166)||(21554924-21554982)
chr7 (108-170)||(47607900-47607962)
chr7 (1-87)||(2846801-2846887)
chr7 (38-87)||(18731338-18731387)
chr7 (38-83)||(47238118-47238163)
chr7 (47-87)||(30462912-30462952)
chr7 (47-87)||(31581620-31581660)
chr7 (108-184)||(5579686-5579764)
chr7 (109-152)||(10326981-10327023)
chr7 (119-170)||(18714457-18714508)
chr7 (110-169)||(19599155-19599214)
chr7 (115-170)||(29237554-29237609)
chr7 (108-184)||(31038512-31038590)
chr7 (109-152)||(42095934-42095977)
chr7 (108-184)||(42829224-42829302)
chr7 (108-183)||(14046601-14046678)
chr7 (108-183)||(14356631-14356708)
chr7 (5-83)||(25778636-25778715)
chr7 (108-170)||(27833391-27833453)
chr7 (108-170)||(46987095-46987157)
chr7 (111-152)||(7670461-7670502)
chr7 (119-152)||(10242507-10242540)
chr7 (120-161)||(18023697-18023738)
chr7 (113-170)||(38374186-38374243)
chr7 (108-161)||(47155094-47155147)
chr7 (47-87)||(7426048-7426088)
chr7 (47-87)||(11616451-11616491)
chr7 (108-168)||(12212285-12212344)
chr7 (111-184)||(19626518-19626593)
chr7 (39-87)||(23111693-23111741)
chr7 (120-152)||(26717930-26717962)
chr7 (108-152)||(33473511-33473555)
chr7 (119-184)||(34448611-34448678)
chr7 (133-169)||(44941428-44941464)
chr7 (111-184)||(46737778-46737853)
chr7 (124-184)||(2618672-2618734)
chr7 (119-183)||(4047780-4047845)
chr7 (136-184)||(5833035-5833085)
chr7 (108-180)||(21174356-21174430)
chr7 (119-166)||(24824413-24824460)
chr7 (131-170)||(25888909-25888948)
chr7 (136-184)||(26816682-26816732)
chr7 (116-184)||(27993027-27993097)
chr7 (108-184)||(37624536-37624614)
chr7 (108-184)||(38088007-38088085)
chr7 (40-87)||(39498570-39498617)
chr7 (109-168)||(48629056-48629115)
chr7 (49-87)||(5724882-5724920)
chr7 (47-81)||(6838602-6838636)
chr7 (108-183)||(20763149-20763225)
chr7 (112-170)||(24656979-24657037)
chr7 (108-183)||(29488715-29488791)
chr7 (108-183)||(33232387-33232463)
chr7 (108-183)||(34284529-34284605)
chr7 (120-170)||(39280820-39280870)
chr7 (135-169)||(39458561-39458595)
chr7 (109-184)||(40752830-40752907)
chr7 (120-170)||(42753529-42753579)
chr7 (112-170)||(43579047-43579105)
chr7 (111-152)||(1079685-1079726)
chr7 (108-182)||(3953436-3953510)
chr7 (108-145)||(5804795-5804832)
chr7 (119-152)||(6781834-6781867)
chr7 (109-170)||(18684139-18684199)
chr7 (111-152)||(19988688-19988729)
chr7 (119-152)||(20085760-20085793)
chr7 (108-185)||(20243247-20243327)
chr7 (38-87)||(26938601-26938650)
chr7 (5-87)||(33774170-33774252)
chr7 (112-165)||(36033458-36033511)
chr7 (111-152)||(36121679-36121720)
chr7 (108-149)||(42219377-42219418)
chr7 (124-152)||(2648299-2648327)
chr7 (108-152)||(8084454-8084498)
chr7 (47-87)||(9658734-9658774)
chr7 (47-87)||(12308276-12308316)
chr7 (108-152)||(16198410-16198454)
chr7 (119-180)||(18505659-18505721)
chr7 (132-168)||(25923402-25923438)
chr7 (109-169)||(27270245-27270305)
chr7 (109-149)||(29986627-29986667)
chr7 (47-87)||(33584458-33584498)
chr7 (47-87)||(34963986-34964026)
chr7 (121-169)||(37230031-37230079)
chr7 (126-183)||(39801700-39801759)
chr7 (119-184)||(43539105-43539172)
chr7 (47-87)||(46095617-46095657)
[»] chr1 (122 HSPs)
chr1 (38-87)||(2886067-2886116)
chr1 (111-184)||(41763148-41763223)
chr1 (108-170)||(15854078-15854140)
chr1 (108-170)||(34521180-34521242)
chr1 (108-166)||(46149034-46149092)
chr1 (5-82)||(29225654-29225731)
chr1 (5-85)||(26583626-26583706)
chr1 (40-87)||(50333831-50333878)
chr1 (108-183)||(17139507-17139584)
chr1 (5-87)||(26924399-26924480)
chr1 (108-157)||(34595894-34595943)
chr1 (5-79)||(37541247-37541321)
chr1 (108-184)||(3481553-3481632)
chr1 (39-87)||(29225571-29225619)
chr1 (119-184)||(37045147-37045214)
chr1 (108-184)||(1794589-1794667)
chr1 (5-81)||(5503319-5503395)
chr1 (108-184)||(5907792-5907870)
chr1 (108-184)||(7925357-7925434)
chr1 (108-184)||(30678803-30678881)
chr1 (108-184)||(42045362-42045440)
chr1 (108-184)||(45139996-45140074)
chr1 (39-85)||(7310706-7310752)
chr1 (112-183)||(26755610-26755683)
chr1 (108-183)||(27533237-27533314)
chr1 (108-170)||(29739346-29739408)
chr1 (5-87)||(29756274-29756357)
chr1 (108-170)||(49431983-49432045)
chr1 (108-170)||(50638906-50638968)
chr1 (114-183)||(25532967-25533038)
chr1 (108-164)||(41973270-41973326)
chr1 (110-169)||(12212305-12212364)
chr1 (108-184)||(16033440-16033518)
chr1 (119-170)||(17283960-17284011)
chr1 (119-183)||(21400024-21400090)
chr1 (8-87)||(31798313-31798393)
chr1 (120-184)||(41769817-41769883)
chr1 (108-167)||(46707884-46707943)
chr1 (119-170)||(50040365-50040416)
chr1 (53-87)||(7787569-7787603)
chr1 (108-166)||(8210375-8210433)
chr1 (108-170)||(8269358-8269420)
chr1 (38-80)||(8773141-8773183)
chr1 (119-169)||(32497482-32497532)
chr1 (108-170)||(35473961-35474023)
chr1 (108-170)||(51503688-51503750)
chr1 (108-165)||(8736449-8736506)
chr1 (119-168)||(12268985-12269034)
chr1 (38-87)||(28424415-28424464)
chr1 (108-169)||(32962573-32962634)
chr1 (38-87)||(36326351-36326400)
chr1 (38-87)||(46363574-46363623)
chr1 (129-169)||(2889937-2889977)
chr1 (43-87)||(3160920-3160964)
chr1 (47-87)||(10587754-10587794)
chr1 (133-169)||(19396206-19396242)
chr1 (108-184)||(24752637-24752716)
chr1 (108-152)||(32950751-32950795)
chr1 (108-185)||(33020033-33020112)
chr1 (108-168)||(41974772-41974832)
chr1 (121-169)||(48264474-48264522)
chr1 (108-170)||(3509931-3509993)
chr1 (109-164)||(8094056-8094111)
chr1 (108-184)||(19620569-19620647)
chr1 (119-170)||(26803452-26803503)
chr1 (56-87)||(36057796-36057827)
chr1 (40-83)||(36232954-36232997)
chr1 (120-184)||(36679583-36679649)
chr1 (119-183)||(37944131-37944197)
chr1 (119-170)||(44243882-44243933)
chr1 (135-170)||(51370582-51370617)
chr1 (108-184)||(52441501-52441579)
chr1 (45-87)||(2246465-2246507)
chr1 (2-80)||(5115952-5116031)
chr1 (111-169)||(7574111-7574169)
chr1 (108-170)||(12783691-12783753)
chr1 (111-186)||(13054864-13054941)
chr1 (47-81)||(19533091-19533125)
chr1 (109-147)||(19795107-19795145)
chr1 (38-87)||(25983789-25983839)
chr1 (119-169)||(29800543-29800593)
chr1 (119-169)||(33153881-33153931)
chr1 (132-183)||(37098495-37098548)
chr1 (124-170)||(38448872-38448918)
chr1 (108-170)||(42888584-42888646)
chr1 (1-87)||(45048927-45049014)
chr1 (43-81)||(50773502-50773540)
chr1 (108-169)||(6000133-6000194)
chr1 (108-145)||(6423751-6423788)
chr1 (108-169)||(9639807-9639868)
chr1 (133-170)||(9872120-9872157)
chr1 (119-152)||(9929232-9929265)
chr1 (108-169)||(10356173-10356234)
chr1 (108-165)||(13778575-13778632)
chr1 (113-170)||(16533028-16533085)
chr1 (108-169)||(17669655-17669716)
chr1 (121-170)||(22346685-22346734)
chr1 (9-79)||(24131534-24131604)
chr1 (124-169)||(24631849-24631894)
chr1 (121-170)||(25086492-25086541)
chr1 (5-87)||(26760054-26760135)
chr1 (108-169)||(29042547-29042608)
chr1 (108-169)||(30382506-30382567)
chr1 (118-184)||(30795694-30795762)
chr1 (38-87)||(32347840-32347889)
chr1 (108-169)||(34766870-34766931)
chr1 (108-169)||(47719097-47719158)
chr1 (108-152)||(64668-64712)
chr1 (43-79)||(8903469-8903505)
chr1 (108-168)||(10132434-10132494)
chr1 (121-169)||(12852205-12852253)
chr1 (40-87)||(16956280-16956325)
chr1 (108-148)||(23309498-23309538)
chr1 (124-152)||(23405364-23405392)
chr1 (121-169)||(32560983-32561031)
chr1 (5-82)||(35622909-35622985)
chr1 (108-152)||(40613050-40613094)
chr1 (137-169)||(41972749-41972781)
chr1 (108-152)||(47417810-47417854)
chr1 (108-185)||(47528437-47528516)
chr1 (47-87)||(50269656-50269696)
chr1 (47-87)||(52432203-52432243)
[»] chr5 (115 HSPs)
chr5 (108-184)||(6489000-6489078)
chr5 (108-183)||(15889405-15889482)
chr5 (108-186)||(34436842-34436922)
chr5 (108-184)||(22522791-22522869)
chr5 (5-87)||(4044606-4044689)
chr5 (108-183)||(5485180-5485257)
chr5 (111-168)||(33412102-33412159)
chr5 (118-184)||(35270681-35270749)
chr5 (108-168)||(22499113-22499173)
chr5 (39-87)||(36007053-36007101)
chr5 (108-184)||(6624769-6624847)
chr5 (108-184)||(32565517-32565595)
chr5 (111-183)||(34191427-34191501)
chr5 (108-184)||(37932323-37932401)
chr5 (108-183)||(3445237-3445314)
chr5 (108-150)||(14474863-14474905)
chr5 (108-170)||(17090875-17090937)
chr5 (108-183)||(40715939-40716016)
chr5 (5-79)||(4194544-4194618)
chr5 (108-169)||(11720904-11720964)
chr5 (108-182)||(16701571-16701647)
chr5 (1-87)||(25109995-25110081)
chr5 (1-87)||(25169087-25169173)
chr5 (5-87)||(34534820-34534902)
chr5 (108-184)||(4009859-4009938)
chr5 (47-87)||(6610731-6610771)
chr5 (110-182)||(16094054-16094126)
chr5 (39-87)||(16926331-16926379)
chr5 (119-184)||(24408488-24408555)
chr5 (108-181)||(39980504-39980579)
chr5 (3-75)||(5072860-5072932)
chr5 (109-152)||(25979871-25979914)
chr5 (108-184)||(31708136-31708214)
chr5 (132-170)||(11017185-11017223)
chr5 (108-170)||(17861988-17862050)
chr5 (133-184)||(20370145-20370198)
chr5 (108-170)||(26655473-26655535)
chr5 (108-170)||(26927058-26927120)
chr5 (112-169)||(979819-979876)
chr5 (5-87)||(3725083-3725165)
chr5 (38-83)||(4475145-4475190)
chr5 (5-87)||(15898088-15898170)
chr5 (5-87)||(31090201-31090282)
chr5 (109-183)||(32200438-32200514)
chr5 (5-83)||(39061084-39061162)
chr5 (111-152)||(42473921-42473962)
chr5 (47-87)||(6629552-6629592)
chr5 (39-87)||(16926253-16926301)
chr5 (47-87)||(22583044-22583084)
chr5 (109-186)||(25509302-25509381)
chr5 (47-87)||(25814256-25814296)
chr5 (108-148)||(27086109-27086149)
chr5 (47-87)||(39008026-39008066)
chr5 (47-87)||(41184001-41184041)
chr5 (108-152)||(42817102-42817146)
chr5 (120-184)||(2839791-2839857)
chr5 (111-170)||(10704324-10704383)
chr5 (108-184)||(13220611-13220688)
chr5 (108-184)||(18331700-18331778)
chr5 (133-185)||(20211272-20211326)
chr5 (108-184)||(28207125-28207203)
chr5 (108-184)||(37614417-37614495)
chr5 (47-86)||(39212746-39212785)
chr5 (119-169)||(866028-866078)
chr5 (119-169)||(3671228-3671278)
chr5 (119-165)||(6424904-6424950)
chr5 (47-85)||(7276282-7276320)
chr5 (108-170)||(11844428-11844490)
chr5 (120-183)||(17210711-17210776)
chr5 (108-170)||(18391609-18391671)
chr5 (108-170)||(18789045-18789107)
chr5 (119-169)||(20258555-20258605)
chr5 (119-169)||(20721060-20721110)
chr5 (108-170)||(27679507-27679569)
chr5 (49-87)||(33012250-33012288)
chr5 (108-170)||(37021362-37021424)
chr5 (108-183)||(37462106-37462182)
chr5 (119-169)||(38495152-38495202)
chr5 (5-87)||(72235-72317)
chr5 (112-169)||(3389172-3389229)
chr5 (109-170)||(5846038-5846099)
chr5 (108-169)||(8350680-8350741)
chr5 (109-170)||(12909157-12909218)
chr5 (108-169)||(13864354-13864415)
chr5 (133-170)||(19068454-19068491)
chr5 (108-149)||(21594376-21594417)
chr5 (108-149)||(21598493-21598534)
chr5 (109-170)||(26409262-26409323)
chr5 (110-184)||(27219281-27219357)
chr5 (122-184)||(27721679-27721743)
chr5 (132-169)||(33654758-33654795)
chr5 (133-183)||(36321509-36321561)
chr5 (124-169)||(43108579-43108624)
chr5 (109-169)||(1745989-1746049)
chr5 (108-168)||(3052290-3052350)
chr5 (47-83)||(4412274-4412310)
chr5 (109-169)||(5107236-5107296)
chr5 (39-79)||(5147644-5147684)
chr5 (47-87)||(11099650-11099690)
chr5 (108-183)||(12611025-12611101)
chr5 (133-169)||(13044449-13044485)
chr5 (133-169)||(13114447-13114483)
chr5 (55-87)||(13716903-13716935)
chr5 (108-152)||(19518590-19518634)
chr5 (110-166)||(20145562-20145618)
chr5 (47-87)||(20189784-20189824)
chr5 (119-184)||(26166733-26166799)
chr5 (108-152)||(31280046-31280090)
chr5 (108-152)||(32339762-32339806)
chr5 (47-87)||(35334700-35334740)
chr5 (108-152)||(35412984-35413027)
chr5 (47-87)||(35646262-35646302)
chr5 (43-87)||(35988523-35988567)
chr5 (108-152)||(36736811-36736855)
chr5 (47-87)||(39060587-39060627)
[»] chr6 (74 HSPs)
chr6 (109-183)||(16390423-16390499)
chr6 (5-84)||(4552801-4552880)
chr6 (109-170)||(33824890-33824951)
chr6 (47-87)||(34915982-34916022)
chr6 (108-184)||(8916464-8916542)
chr6 (108-184)||(29740475-29740553)
chr6 (108-183)||(17151230-17151307)
chr6 (119-168)||(291378-291427)
chr6 (108-169)||(8569719-8569780)
chr6 (121-170)||(14917778-14917827)
chr6 (119-184)||(866286-866353)
chr6 (47-83)||(9755311-9755347)
chr6 (108-184)||(9333724-9333802)
chr6 (119-187)||(20744128-20744198)
chr6 (108-184)||(28231415-28231493)
chr6 (115-182)||(3640512-3640581)
chr6 (120-170)||(8639055-8639105)
chr6 (41-87)||(15351548-15351594)
chr6 (41-87)||(15372028-15372074)
chr6 (109-184)||(32053781-32053858)
chr6 (119-169)||(32524421-32524471)
chr6 (108-169)||(2726407-2726468)
chr6 (108-169)||(8629686-8629747)
chr6 (119-168)||(8637438-8637487)
chr6 (108-169)||(8831217-8831277)
chr6 (119-152)||(18253340-18253373)
chr6 (108-169)||(28951409-28951470)
chr6 (38-87)||(33921631-33921680)
chr6 (5-87)||(34803836-34803918)
chr6 (111-184)||(655742-655817)
chr6 (108-185)||(788858-788937)
chr6 (47-87)||(33109269-33109309)
chr6 (111-183)||(331879-331953)
chr6 (119-187)||(9977047-9977117)
chr6 (119-170)||(14918301-14918352)
chr6 (108-184)||(21847187-21847265)
chr6 (108-167)||(24248177-24248236)
chr6 (111-170)||(26356074-26356133)
chr6 (108-184)||(27907941-27908019)
chr6 (119-170)||(30960054-30960105)
chr6 (109-152)||(34474254-34474297)
chr6 (108-183)||(247654-247730)
chr6 (108-170)||(4455586-4455648)
chr6 (124-170)||(7414341-7414387)
chr6 (111-157)||(8393745-8393791)
chr6 (108-170)||(10018409-10018470)
chr6 (8-87)||(15321357-15321436)
chr6 (121-183)||(21029369-21029434)
chr6 (132-170)||(30639440-30639478)
chr6 (119-169)||(31971539-31971589)
chr6 (112-183)||(33976239-33976311)
chr6 (108-169)||(4467288-4467349)
chr6 (108-149)||(10507518-10507559)
chr6 (134-180)||(10780123-10780171)
chr6 (121-183)||(18256877-18256940)
chr6 (108-169)||(24373700-24373761)
chr6 (120-169)||(29283825-29283874)
chr6 (39-75)||(2657808-2657844)
chr6 (108-152)||(4450289-4450333)
chr6 (119-184)||(9111040-9111107)
chr6 (108-152)||(12184535-12184579)
chr6 (112-152)||(12215780-12215820)
chr6 (119-184)||(12333569-12333636)
chr6 (108-148)||(12440694-12440734)
chr6 (108-152)||(12700411-12700455)
chr6 (121-169)||(14429131-14429179)
chr6 (38-82)||(15081324-15081368)
chr6 (108-152)||(15155762-15155806)
chr6 (108-152)||(15187090-15187134)
chr6 (108-152)||(15473472-15473516)
chr6 (111-184)||(21296751-21296825)
chr6 (110-166)||(28898869-28898925)
chr6 (47-87)||(30064119-30064159)
chr6 (108-168)||(34701158-34701218)
[»] scaffold0027 (1 HSPs)
scaffold0027 (108-169)||(61560-61621)
[»] scaffold0007 (3 HSPs)
scaffold0007 (5-83)||(157927-158005)
scaffold0007 (108-170)||(221003-221065)
scaffold0007 (50-87)||(230152-230189)
[»] scaffold0155 (1 HSPs)
scaffold0155 (40-87)||(8117-8164)
[»] scaffold0038 (1 HSPs)
scaffold0038 (108-184)||(31912-31990)
[»] scaffold0247 (1 HSPs)
scaffold0247 (120-170)||(20989-21039)
[»] scaffold0238 (1 HSPs)
scaffold0238 (119-169)||(25399-25449)
[»] scaffold0026 (1 HSPs)
scaffold0026 (108-170)||(75334-75396)
[»] scaffold0011 (1 HSPs)
scaffold0011 (109-184)||(185256-185333)
[»] scaffold0126 (1 HSPs)
scaffold0126 (124-169)||(34894-34939)
[»] scaffold1149 (1 HSPs)
scaffold1149 (111-184)||(2325-2400)
[»] scaffold0983 (1 HSPs)
scaffold0983 (111-184)||(3308-3383)
[»] scaffold0034 (1 HSPs)
scaffold0034 (48-80)||(97962-97994)
[»] scaffold0028 (1 HSPs)
scaffold0028 (120-152)||(72777-72809)
[»] scaffold0040 (1 HSPs)
scaffold0040 (108-184)||(56777-56854)
[»] scaffold0001 (1 HSPs)
scaffold0001 (56-87)||(394673-394704)
[»] scaffold1127 (1 HSPs)
scaffold1127 (119-165)||(1166-1212)
[»] scaffold0735 (1 HSPs)
scaffold0735 (108-170)||(1537-1599)
[»] scaffold0180 (1 HSPs)
scaffold0180 (108-170)||(17741-17802)
[»] scaffold0118 (1 HSPs)
scaffold0118 (115-186)||(39989-40062)
[»] scaffold0016 (1 HSPs)
scaffold0016 (120-183)||(99031-99096)
[»] scaffold0005 (1 HSPs)
scaffold0005 (112-170)||(239816-239874)
[»] scaffold0143 (1 HSPs)
scaffold0143 (121-166)||(4479-4524)
[»] scaffold0050 (1 HSPs)
scaffold0050 (108-169)||(53370-53431)
[»] scaffold0021 (1 HSPs)
scaffold0021 (108-169)||(161151-161212)
[»] scaffold0045 (1 HSPs)
scaffold0045 (47-87)||(26219-26259)
[»] scaffold0006 (2 HSPs)
scaffold0006 (43-87)||(98822-98866)
scaffold0006 (43-87)||(108100-108144)


Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 146)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 108 - 236
Target Start/End: Original strand, 4360634 - 4360762
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagcagctcacgaggacagacggagggagtactaaactatc 207  Q
    ||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||    
4360634 gtggtcgccgaggtttgaaccctgcaccttgcatatattatgcatcatccctaccaactgagcagctcacgaggacggacagagggagtactaaactatc 4360733  T
208 gtatattggtattaaaaacatgtctctgc 236  Q
    |||||||||||||||||||||||||||||    
4360734 gtatattggtattaaaaacatgtctctgc 4360762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 50362129 - 50362207
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||||| |||||||||||||||||||||||||||||||||||  ||||||||||||||||  ||||||||||||||    
50362129 gtggtggccaaggtttgaaccctggaccttgcatatattatgcattgtccctaccaactgagctaagctcacgaggaca 50362207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 5 - 87
Target Start/End: Original strand, 20964423 - 20964505
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||  |||||       ||||||||||||||||||||||||||||||||||||||||||||||||||    
20964423 ttgtattgaaaagtgaaataggtcaatttttctgggacaatatttttttgcaaatgactcagttattatgggacggagggagt 20964505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 7230351 - 7230273
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||||||||||||||| ||||||||||||||||||||||  ||| ||||||||||||  ||||||||||||||    
7230351 gtggtggccgaggtttgaaccccggaccttgcatatattatgcattgtccttaccaactgagctaagctcacgaggaca 7230273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 28330770 - 28330688
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||| |||||       |||||| ||||||||||||||||  |||||||||||||||||||||||||    
28330770 ttgtattgaaaagtgaaatgggtcaatttttatgggacagtatttttttgcaaatgggtcagttattatgggacggagggagt 28330688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 5 - 82
Target Start/End: Original strand, 36047230 - 36047308
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatattttt-ttgcaaatgactcagttattatgggacggag 82  Q
    ||||||||||||||||||||||||||       | |||||||||||| |||||||||||||||||||||||||||||||    
36047230 ttgtattgaaaagtgaaatgagtcaatttttctgagacaatatttttcttgcaaatgactcagttattatgggacggag 36047308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 53848310 - 53848229
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||| |||||       | |||||||||||||||||||||||||||||||||||||| |||||||||    
53848310 ttgtattgaaaagtgaaatgggtcaattttct-gagacaatatttttttgcaaatgactcagttattatgggatggagggagt 53848229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 119 - 183
Target Start/End: Original strand, 20799395 - 20799461
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    ||||||||||| ||||||||||||||||||||||  ||||||||||||||||  |||||||||||||    
20799395 ggtttgaaccccggaccttgcatatattatgcattgtccctaccaactgagctaagctcacgaggac 20799461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 12322744 - 12322667
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||| ||||||||||||| ||| ||||||||||||||||||  ||| ||||||||||||  |||||||||||||    
12322744 gtggtggctgaggtttgaaccccggaacttgcatatattatgcattgtccgtaccaactgagctaagctcacgaggac 12322667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 19588225 - 19588148
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||||| ||||||||||||||||||||||||| ||||||||  ||| |||||| |||||  |||||||||||||    
19588225 gtggtggccggggtttgaaccctggaccttgcatattttatgcattgtccataccaattgagctaagctcacgaggac 19588148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 23810020 - 23809943
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||||| ||||||||||||| |||||||||||||||||| |  ||| ||||||||||||  |||||||||||||    
23810020 gtggtggccggggtttgaaccctgaaccttgcatatattatgctttgtccataccaactgagctaagctcacgaggac 23809943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 21318243 - 21318304
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||| || |||||||||||| |||||||||||||||||||||  |||||||||||||||    
21318243 gtggtggtcggggtttgaaccctagaccttgcatatattatgcattgtccctaccaactgag 21318304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 108 - 186
Target Start/End: Original strand, 24664981 - 24665061
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacaga 186  Q
    ||||||| || |||| |||||| ||||||||||||||||||||||  ||| ||||||||||||  ||||||||||||||||    
24664981 gtggtggtcggggttcgaaccccggaccttgcatatattatgcattctccataccaactgagctaagctcacgaggacaga 24665061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 44633138 - 44633052
Alignment:
1 aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||||||||||||||       ||||| |||||||||| |||||| ||| |||||||| ||| |||||||||    
44633138 aatgttgtattgaaaagtgaaatgagtcaagattcttgggactatatttttttacaaatggctccgttattataggatggagggagt 44633052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 4360533 - 4360618
Alignment:
1 aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||||||  |||||       | ||||||||||||||| ||||| ||||||||||||||||||||||||||    
4360533 aatgttgtattgaaaagtgaaattggtcaatttttt-gtgacaatatttttttgtaaatggctcagttattatgggacggagggagt 4360618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 11949753 - 11949831
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||| || ||||||||||| ||||||||||||||||||||||  ||| ||||||||||||  |||||| |||||||    
11949753 gtggtggtcggggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagctaagctcatgaggaca 11949831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 23304006 - 23304084
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| |||| | |||| |||||||||||||||||||| |  ||||||||||||||||  ||||||||||||||    
23304006 gtggtggccggggttcgcaccccggaccttgcatatattatgccttgtccctaccaactgagctaagctcacgaggaca 23304084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 38453336 - 38453258
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||| | |||| |||||||||||||||||||||||||||||  ||| | ||||||||||  ||||||||||||||    
38453336 gtggtggctggggttcgaaccctggaccttgcatatattatgcattgtccatgccaactgagctaagctcacgaggaca 38453258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 47386611 - 47386697
Alignment:
1 aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttt--tttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||| ||||||||||||||       |||||||||||||  ||||||||||||||| |||||||||||||||||||||    
47386611 aatgttgtattgaaa-gtgaaatgagtcaatttttt-gggacaatatttttttttgcaaatgactcacttattatgggacggagggagt 47386697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 9946498 - 9946421
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    ||||||| || ||||||||||| ||||||||||||| ||||||||  ||| ||||||||||||  |||||||||||||    
9946498 gtggtggtcggggtttgaaccccggaccttgcatattttatgcattgtccataccaactgagctaagctcacgaggac 9946421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 124 - 170
Target Start/End: Complemental strand, 53190350 - 53190304
Alignment:
124 gaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||||||||||||||||||||| |||| ||||||||||||    
53190350 gaaccctggaccttgcatatattatgcattatccataccaactgagc 53190304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 56551582 - 56551644
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||| ||||||||||  ||||||||||||||||||||||  ||| ||||||||||||    
56551582 gtggtggccggggtttgaacctcggaccttgcatatattatgcattgtccttaccaactgagc 56551644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 109 - 170
Target Start/End: Original strand, 16304089 - 16304150
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||| |||||||| || ||||||||||||||||||||||  ||| ||||||||||||    
16304089 tggtggccgcggtttgaatcccggaccttgcatatattatgcattgtccataccaactgagc 16304150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 6 - 87
Target Start/End: Original strand, 21954833 - 21954915
Alignment:
6 tgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttt-tttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||  |||||       ||||||||||||| ||||||||||||||| ||||||||| |||||||||||    
21954833 tgtattgaaaagtgaaattggtcaatttttttgggacaatattttttttgcaaatgactcacttattatggtacggagggagt 21954915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 38319889 - 38319807
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||||||||||       |  |||||||||| |||||| ||  |||||||||||||||||||||||||    
38319889 ttgtattgaaaagtgaaatgagtcaatttttcagaaacaatattttgttgcaagtggttcagttattatgggacggagggagt 38319807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 47490697 - 47490758
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||||||||||||||| | ||||||||||| ||| |||| |||| |||||||||||    
47490697 gtggtggccgaggtttgaacccggaaccttgcatattttacgcattatccataccaactgag 47490758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 5 - 87
Target Start/End: Original strand, 49218912 - 49218988
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||||||||||        ||||||||||||| || ||||| ||||||||||||||||| ||||||||    
49218912 ttgtattgaaaagtgaaatgagtcaatt------ggacaatatttttgtgaaaatggctcagttattatgggactgagggagt 49218988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 111 - 184
Target Start/End: Original strand, 10303504 - 10303579
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||||| |||||| ||| ||||||||| ||||||||  ||| ||||||||||||  ||||||||||||||    
10303504 gtggccgaggttcgaaccccggatcttgcatattttatgcattgtccttaccaactgagctaagctcacgaggaca 10303579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 119 - 167
Target Start/End: Complemental strand, 23775578 - 23775530
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactg 167  Q
    |||| |||||||||||||||||||||||||||||  |||||||||||||    
23775578 ggttcgaaccctggaccttgcatatattatgcattgtccctaccaactg 23775530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 25390652 - 25390612
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||| ||||||||||||||||||||||||||||||||||||    
25390652 ttttgttgcaaatgactcagttattatgggacggagggagt 25390612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 48740457 - 48740417
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||||||||||| ||||||||||||    
48740457 tttttttgcaaatgactcagttattatgagacggagggagt 48740417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 49041971 - 49042015
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||| ||||||||||| ||||||||||||||||||||||    
49041971 gtggtggccggggtttgaaccccggaccttgcatatattatgcat 49042015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 5 - 82
Target Start/End: Complemental strand, 54217320 - 54217243
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggag 82  Q
    |||||||||||| |||||||||||||        | |||||||||||||| ||||||||||| |||||||||||||||    
54217320 ttgtattgaaaaatgaaatgagtcaatttttctagaacaatatttttttgtaaatgactcagctattatgggacggag 54217243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 187
Target Start/End: Complemental strand, 2888945 - 2888863
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgca-tcatccctaccaactgagc--agctcacgaggacagac 187  Q
    |||||||||| ||||||||||  |||||||||||||||||| || |  ||||||||||||||||  ||||||| |||||||||    
2888945 gtggtggccggggtttgaaccgcggaccttgcatatattatacatttgtccctaccaactgagctaagctcacaaggacagac 2888863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 8495058 - 8494980
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| | ||||||| | ||| ||||||||||||||||||  ||||||||||||||||  || |||||||||||    
8495058 gtggtggccgggatttgaactcgggatcttgcatatattatgcattgtccctaccaactgagctaagttcacgaggaca 8494980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 119 - 170
Target Start/End: Complemental strand, 20383548 - 20383497
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||| ||||||||||||||||||||||  ||| ||||||||||||    
20383548 ggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagc 20383497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 119 - 183
Target Start/End: Complemental strand, 44816001 - 44815935
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    ||||||||||| |||||||||||||||||||||| ||||   ||||||||||  |||||||||||||    
44816001 ggtttgaaccccggaccttgcatatattatgcattatcctatccaactgagcttagctcacgaggac 44815935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 109 - 167
Target Start/End: Complemental strand, 281661 - 281603
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactg 167  Q
    ||||| ||||||||||||||| ||||||| ||||||||||||||  ||| |||||||||    
281661 tggtgtccgaggtttgaaccccggacctttcatatattatgcattgtccataccaactg 281603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 111 - 169
Target Start/End: Original strand, 2434451 - 2434509
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||| ||||||||||||||  ||||||||||||| |||||||| || ||||||||||||    
2434451 gtggtcgaggtttgaacccctgaccttgcatatagtatgcatcgtctctaccaactgag 2434509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 3936698 - 3936636
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||| |||| |||||| ||||||||||||||||||||||  | | ||||||||||||    
3936698 gtggtggccggggttcgaaccccggaccttgcatatattatgcattgttcataccaactgagc 3936636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 109 - 184
Target Start/End: Complemental strand, 6087817 - 6087740
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||| | |||||||||||  ||||||||||||||||||||| |||  ||||||||||||  ||||||| ||||||    
6087817 tggtggctggggtttgaaccccagaccttgcatatattatgcattatctataccaactgagctaagctcacaaggaca 6087740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 8027387 - 8027449
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||| || |||||||||||  || |||||||||||||||||| |||| ||||||||||||    
8027387 gtggtggtcggggtttgaacccccgatcttgcatatattatgcattatccttaccaactgagc 8027449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 150
Target Start/End: Complemental strand, 11198399 - 11198357
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgc 150  Q
    |||||||||| ||||||||||| ||||||||||||||||||||    
11198399 gtggtggccggggtttgaaccccggaccttgcatatattatgc 11198357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 44 - 78
Target Start/End: Complemental strand, 18509781 - 18509747
Alignment:
44 atatttttttgcaaatgactcagttattatgggac 78  Q
    |||||||||||||||||||||||||||||||||||    
18509781 atatttttttgcaaatgactcagttattatgggac 18509747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 19854636 - 19854574
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||| |||||||| |||||| ||| ||||||||||||||||||  ||| ||||||||||||    
19854636 gtggtgtccgaggttcgaaccccggatcttgcatatattatgcattgtccataccaactgagc 19854574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 21317328 - 21317390
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||  |||||||||||||  |||||||||||||||||||||  || |||||||||||||    
21317328 gtggtggttgaggtttgaacccctgaccttgcatatattatgcattgtctctaccaactgagc 21317390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 28435238 - 28435300
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||| | ||||||||||| | ||||||||||||||||||||  ||| ||||||||||||    
28435238 gtggtggctggggtttgaaccccgaaccttgcatatattatgcattgtccataccaactgagc 28435300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 29550852 - 29550911
Alignment:
1 aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatg 60  Q
    |||||||||||||||||||||||| |||||       |||||||||||||||||||||||    
29550852 aatgttgtattgaaaagtgaaatgggtcaagattcttgggacaatatttttttgcaaatg 29550911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 35287497 - 35287574
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||||| |||| |||||| ||||||||||||| ||||||||  | | ||||||||||||  |||||||||||||    
35287497 gtggtggccggggttggaaccccggaccttgcatattttatgcattgttcataccaactgagctaagctcacgaggac 35287574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 166
Target Start/End: Complemental strand, 38375028 - 38374970
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaact 166  Q
    |||||||||| ||||||||| |  |||||||||||||||||||||  ||||||||||||    
38375028 gtggtggccggggtttgaactccagaccttgcatatattatgcattgtccctaccaact 38374970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 43034332 - 43034409
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggac 183  Q
    |||||||||| ||||||||||   |||||||||||||||||||||  ||| |||||||||||   |||||||||||||    
43034332 gtggtggccggggtttgaacctcagaccttgcatatattatgcattgtccataccaactgagttaagctcacgaggac 43034409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 132 - 170
Target Start/End: Original strand, 50442761 - 50442799
Alignment:
132 gaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||||||||||||| |||||||||||||||||    
50442761 gaccttgcatatattatgcattatccctaccaactgagc 50442799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 111 - 169
Target Start/End: Complemental strand, 56205014 - 56204957
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||||||||| || ||||||||||||||||||||||  ||| |||||||||||    
56205014 gtggccgaggtttgaatcc-ggaccttgcatatattatgcattgtccttaccaactgag 56204957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 111 - 152
Target Start/End: Complemental strand, 10148247 - 10148206
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||||||||||||| ||| ||||||||||||||||||||    
10148247 gtggccgaggtttgaactctgaaccttgcatatattatgcat 10148206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 120 - 169
Target Start/End: Original strand, 17423179 - 17423228
Alignment:
120 gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||| ||||||||||||||||||||||  || ||||||||||||    
17423179 gtttgaaccccggaccttgcatatattatgcattgtctctaccaactgag 17423228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 119 - 152
Target Start/End: Complemental strand, 18094465 - 18094432
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||||||||||||||||||||||||||||||    
18094465 ggtttgaaccctggaccttgcatatattatgcat 18094432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 132 - 169
Target Start/End: Original strand, 20096284 - 20096321
Alignment:
132 gaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||||||||||||||||| ||||||||||||||||    
20096284 gaccttgcatatattatgcattatccctaccaactgag 20096321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 120 - 165
Target Start/End: Original strand, 25783451 - 25783496
Alignment:
120 gtttgaaccctggaccttgcatatattatgcatcatccctaccaac 165  Q
    |||||||||| ||||||||||||||||||||||  |||||||||||    
25783451 gtttgaaccccggaccttgcatatattatgcattgtccctaccaac 25783496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 116 - 169
Target Start/End: Complemental strand, 29908119 - 29908066
Alignment:
116 cgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||||| | ||||||||||||||||||||||  ||| |||||||||||    
29908119 cgaggtttgaactccggaccttgcatatattatgcattgtccttaccaactgag 29908066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 109 - 170
Target Start/End: Complemental strand, 32006570 - 32006509
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||  |||||||||| | || || |||||||||||||| |||||||||||||||||    
32006570 tggtggccggagtttgaaccccgaactttacatatattatgcattatccctaccaactgagc 32006509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 42024326 - 42024412
Alignment:
1 aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||| |||||||||||||||||||| |||         ||||| | |||| ||| ||||||||||||||||||||||||||||||||    
42024326 aatgatgtattgaaaagtgaaatgactcatttatcttaggacacttttttattgaaaatgactcagttattatgggacggagggagt 42024412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 38 - 87
Target Start/End: Complemental strand, 42132758 - 42132709
Alignment:
38 gggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||| ||||||||||||||||||||||||||| || | |||||||    
42132758 gggacaataattttttgcaaatgactcagttattatgagatgtagggagt 42132709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 42 - 87
Target Start/End: Complemental strand, 46958662 - 46958617
Alignment:
42 caatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||| |||||||| || |||||||||||||||||||||||    
46958662 caatatttttatgcaaatggcttagttattatgggacggagggagt 46958617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 9093904 - 9093944
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||| ||||||||||||||||||||||||||| |||||    
9093904 tttttttacaaatgactcagttattatgggacggaaggagt 9093944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 117 - 169
Target Start/End: Original strand, 14197430 - 14197482
Alignment:
117 gaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||||||||| ||| ||| ||||||||||||||  |||||||||||||||    
14197430 gaggtttgaaccccggatcttacatatattatgcattgtccctaccaactgag 14197482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 21449889 - 21449932
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||| ||||||||||||||||||||||||||| ||||||    
21449889 gtggtggccg-ggtttgaaccctggaccttgcatatatcatgcat 21449932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 112 - 168
Target Start/End: Original strand, 21623413 - 21623469
Alignment:
112 tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga 168  Q
    |||||||||||| ||||   |||||||||||||||||||||  ||||||||||||||    
21623413 tggccgaggtttaaacctcagaccttgcatatattatgcattgtccctaccaactga 21623469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 34042311 - 34042267
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||| |||||||||||||| | ||||||||||||||||||||    
34042311 gtggtggtcgaggtttgaaccccgaaccttgcatatattatgcat 34042267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 39053073 - 39053113
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||| |||||||||||||||||||| |||||||||||    
39053073 tttttttgtaaatgactcagttattatggaacggagggagt 39053113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 39258447 - 39258487
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||| ||||||||||||||||||||||| |||||||||    
39258447 tttttttacaaatgactcagttattatgggatggagggagt 39258487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 41594875 - 41594915
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||| |||| |||||||||||||||||||||    
41594875 tttttttgcaaatggctcacttattatgggacggagggagt 41594915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 42670552 - 42670592
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||||||||||| ||||||| ||||    
42670552 tttttttgcaaatgactcagttattatgagacggagcgagt 42670592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 111 - 184
Target Start/End: Original strand, 47814244 - 47814319
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||| ||||||||||| |||||||||||||||||||  |  ||| ||||||||||||  |||| |||||||||    
47814244 gtggccggggtttgaaccccggaccttgcatatattatgtgttgtccataccaactgagctaagcttacgaggaca 47814319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 119 - 184
Target Start/End: Complemental strand, 49473705 - 49473638
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||| |||||| ||||||||||||||||||||||  ||| ||||||||| ||  ||||||||||||||    
49473705 ggttcgaaccccggaccttgcatatattatgcattgtccttaccaactgggctaagctcacgaggaca 49473638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #75
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 54294412 - 54294456
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||| ||| ||||||||||| ||||||||||||||||||||||    
54294412 gtggtgtccggggtttgaaccccggaccttgcatatattatgcat 54294456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #76
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 54857605 - 54857649
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||| ||||||||||| ||||||||||||| ||||||||    
54857605 gtggtggccggggtttgaaccccggaccttgcatattttatgcat 54857649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #77
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 119 - 170
Target Start/End: Complemental strand, 675978 - 675927
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||| ||||||||||||||||||||||  |||  |||||||||||    
675978 ggtttgaaccccggaccttgcatatattatgcattgtccaaaccaactgagc 675927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #78
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 132 - 184
Target Start/End: Original strand, 2186347 - 2186401
Alignment:
132 gaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||||||||||||||  ||| ||||||||||||  ||||||||||||||    
2186347 gaccttgcatatattatgcattgtccataccaactgagctaagctcacgaggaca 2186401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #79
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 131 - 170
Target Start/End: Original strand, 2649746 - 2649785
Alignment:
131 ggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||||||||||||||  ||||||||||||||||    
2649746 ggaccttgcatatattatgcattgtccctaccaactgagc 2649785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #80
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 16470375 - 16470297
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||| || |||| |||||||||||||||||||| ||||||||  ||| |||||| |||||   |||||||||||||    
16470375 gtggtggtcggggttcgaaccctggaccttgcatattttatgcattgtccataccaattgagctacgctcacgaggaca 16470297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #81
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 17728153 - 17728075
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||||||   |||||||| || |||| ||||||||||||||| |||| ||||||||||||   |||||||||||||    
17728153 gtggtggccggaatttgaaccatgaacctagcatatattatgcattatccataccaactgagctatgctcacgaggaca 17728075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #82
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 109 - 152
Target Start/End: Original strand, 19479468 - 19479511
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||| || ||||||||||| ||||||||||||||||||||||    
19479468 tggtggtcggggtttgaaccccggaccttgcatatattatgcat 19479511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #83
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 143
Target Start/End: Original strand, 29240213 - 29240248
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatat 143  Q
    |||||||||||||||||||||||||||||| |||||    
29240213 gtggtggccgaggtttgaaccctggaccttacatat 29240248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #84
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 73
Target Start/End: Original strand, 35029226 - 35029294
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattat 73  Q
    ||||||||||||||||||||| ||||       || ||||||||||||||||||||||||  |||||||    
35029226 ttgtattgaaaagtgaaatgaatcaattttgttggaacaatatttttttgcaaatgactcgcttattat 35029294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #85
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 120 - 184
Target Start/End: Complemental strand, 36035893 - 36035827
Alignment:
120 gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| |||||||| ||||||||||||| ||||  || ||||||||  ||||||||||||||    
36035893 gtttgaaccccggaccttggatatattatgcattatccaaactaactgagctaagctcacgaggaca 36035827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #86
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 119 - 183
Target Start/End: Original strand, 39171371 - 39171437
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    ||||||||||||| ||||||||||| ||||||||  ||| || |||||||||  |||||||||||||    
39171371 ggtttgaaccctgaaccttgcatattttatgcattgtccatatcaactgagctaagctcacgaggac 39171437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #87
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 132 - 184
Target Start/End: Original strand, 52270044 - 52270098
Alignment:
132 gaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||||||||||||||  ||| ||||||||||||  ||||||||||||||    
52270044 gaccttgcatatattatgcattgtccataccaactgagctaagctcacgaggaca 52270098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #88
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 120 - 180
Target Start/End: Complemental strand, 54500628 - 54500566
Alignment:
120 gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgag 180  Q
    |||||||||| ||||||| ||||||||||||||  || |||||||||||||  ||||||||||    
54500628 gtttgaaccccggaccttacatatattatgcattgtctctaccaactgagctaagctcacgag 54500566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #89
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 87
Target Start/End: Original strand, 283650 - 283688
Alignment:
49 tttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||| |||||||||||||||||| ||||    
283650 tttttgcaaatgacttagttattatgggacggagtgagt 283688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #90
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 120 - 170
Target Start/End: Original strand, 836237 - 836287
Alignment:
120 gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||  |||||||||||||||| |||||  ||||||||||||||||    
836237 gtttgaacctcggaccttgcatatattttgcattgtccctaccaactgagc 836287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #91
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 2034085 - 2034147
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||| ||||| |||||||||  ||||||  ||||||||||||| |||| ||||||||||||    
2034085 gtggtgtccgagatttgaaccccagaccttaaatatattatgcattatccataccaactgagc 2034147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #92
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 2587691 - 2587752
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||| | ||||||||||| ||||||| |||||||||||||| |||| |||||| |||||    
2587691 gtggtggctggggtttgaaccc-ggaccttacatatattatgcattatccataccaattgagc 2587752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #93
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 5924720 - 5924658
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||| |||||||||||||| ||||||| ||||||||||| ||  ||| || |||||||||    
5924720 gtggtggtcgaggtttgaaccccggaccttccatatattatgtattgtccatagcaactgagc 5924658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #94
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 10261759 - 10261835
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||||| ||||||||| | ||||||||||||| ||||||||  | |||||||||| |||  |||||||||||||    
10261759 gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac 10261835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #95
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 132 - 183
Target Start/End: Complemental strand, 13121591 - 13121538
Alignment:
132 gaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||||||||||||||||  |||||||||||| |||  |||||||||||||    
13121591 gaccttgcatatattatgcattgtccctaccaactaagctaagctcacgaggac 13121538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #96
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 112 - 170
Target Start/End: Original strand, 14577501 - 14577559
Alignment:
112 tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||| ||||||||| | |||| |||||||||||||||||  ||| ||||||||||||    
14577501 tggccggggtttgaactccggactttgcatatattatgcattgtccttaccaactgagc 14577559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #97
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 16431687 - 16431625
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||| ||||| |||||||||||  |||||||||||| ||||||||  ||| ||||||||||||    
16431687 gtggaggccggggtttgaaccccagaccttgcatattttatgcattgtccataccaactgagc 16431625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #98
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 21562696 - 21562620
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||||| ||||||||| | ||||||||||||| ||||||||  | |||||||||| |||  |||||||||||||    
21562696 gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac 21562620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #99
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 120 - 170
Target Start/End: Complemental strand, 23160099 - 23160049
Alignment:
120 gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||  ||||||| ||||||||||||||  ||||||||||||||||    
23160099 gtttgaacctcggaccttacatatattatgcattgtccctaccaactgagc 23160049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #100
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 23247588 - 23247665
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||||| ||||| |||||  ||||||||||||||||||| |  ||| ||||||| ||||  |||||||||||||    
23247588 gtggtggccggggtttaaaccccagaccttgcatatattatgcgttgtccataccaaccgagctaagctcacgaggac 23247665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #101
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 169
Target Start/End: Complemental strand, 25115109 - 25115059
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||||||||| ||||||||||| ||||||||  ||| |||||||||||    
25115109 ggtttgaaccctgaaccttgcatatgttatgcattgtccataccaactgag 25115059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #102
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 26926700 - 26926776
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||||| ||||||||| | ||||||||||||| ||||||||  | |||||||||| |||  |||||||||||||    
26926700 gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac 26926776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #103
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 28279819 - 28279760
Alignment:
1 aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatg 60  Q
    ||||||||||||||||||||||||||||||       ||||||||||||| || ||||||    
28279819 aatgttgtattgaaaagtgaaatgagtcaagattcttgggacaatattttgttacaaatg 28279760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #104
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 128 - 170
Target Start/End: Complemental strand, 34247491 - 34247449
Alignment:
128 cctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||||||||||||||||||  ||| ||||||||||||    
34247491 cctggaccttgcatatattatgcattgtccttaccaactgagc 34247449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #105
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 41 - 87
Target Start/End: Original strand, 37316087 - 37316133
Alignment:
41 acaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||| |||||||||| |||||||  ||||||||||||    
37316087 acaatatttttttgaaaatgactcaattattataagacggagggagt 37316133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #106
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 37921817 - 37921755
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||| |||| |||||||| || ||||||||||||||||||||||  ||| ||| ||||||||    
37921817 gtggtagccggggtttgaatcccggaccttgcatatattatgcattgtccttactaactgagc 37921755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #107
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 87
Target Start/End: Original strand, 39976564 - 39976602
Alignment:
49 tttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||||||||| ||||||| ||||    
39976564 tttttgcaaatgactcagttattatgagacggagtgagt 39976602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #108
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 47 - 77
Target Start/End: Complemental strand, 41203640 - 41203610
Alignment:
47 tttttttgcaaatgactcagttattatggga 77  Q
    |||||||||||||||||||||||||||||||    
41203640 tttttttgcaaatgactcagttattatggga 41203610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #109
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 43330217 - 43330141
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||||| ||||||||| | ||||||||||||| ||||||||  | |||||||||| |||  |||||||||||||    
43330217 gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac 43330141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #110
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 169
Target Start/End: Complemental strand, 43722825 - 43722775
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||||||| ||||||| ||||||||||||||  ||| |||||||||||    
43722825 ggtttgaaccccggaccttacatatattatgcattgtccataccaactgag 43722775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #111
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 124 - 170
Target Start/End: Original strand, 46676504 - 46676550
Alignment:
124 gaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||| ||||||||||||||||||||||  ||| ||||||||||||    
46676504 gaaccccggaccttgcatatattatgcattgtccttaccaactgagc 46676550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #112
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 51450283 - 51450207
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||||| ||||||||| | ||||||||||||| ||||||||  | |||||||||| |||  |||||||||||||    
51450283 gtggtggccggggtttgaactccggaccttgcatatcttatgcattgt-cctaccaactaagctaagctcacgaggac 51450207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #113
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 38 - 87
Target Start/End: Complemental strand, 8759725 - 8759676
Alignment:
38 gggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||| |||||||||||||||| |||  ||||||||||||||| |||||    
8759725 gggacagtatttttttgcaaatggctccattattatgggacggaaggagt 8759676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #114
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 149
Target Start/End: Complemental strand, 8760307 - 8760266
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatg 149  Q
    |||||||||||||||||||| ||||| ||||||||| |||||    
8760307 gtggtggccgaggtttgaactctggatcttgcatattttatg 8760266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #115
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 149
Target Start/End: Complemental strand, 10035336 - 10035295
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatg 149  Q
    |||||||||| |||||||||||  ||||||||||||||||||    
10035336 gtggtggccggggtttgaaccccagaccttgcatatattatg 10035295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #116
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 19908763 - 19908702
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||| || |||| |||||  ||||||||||||||||||||||  ||| |||||||||||    
19908763 gtggtggtcggggttcgaacctcggaccttgcatatattatgcattgtccttaccaactgag 19908702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #117
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 111 - 148
Target Start/End: Original strand, 20566735 - 20566771
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatattat 148  Q
    ||||||||||||||||||| ||||||||||||||||||    
20566735 gtggccgaggtttgaaccc-ggaccttgcatatattat 20566771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #118
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 165
Target Start/End: Original strand, 21114295 - 21114352
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaac 165  Q
    ||||||| || ||||||||||| ||||||||||||||| ||||||  ||| |||||||    
21114295 gtggtggtcggggtttgaaccccggaccttgcatatatcatgcattgtccataccaac 21114352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #119
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 119 - 152
Target Start/End: Original strand, 30850385 - 30850418
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||||||||| ||||||||||||||||||||    
30850385 ggtttgaaccctgaaccttgcatatattatgcat 30850418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #120
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 5 - 79
Target Start/End: Complemental strand, 34021013 - 34020939
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacg 79  Q
    ||||||||||||||||||||| |||        | |||| | |||||||||||||||||| ||||||||||||||    
34021013 ttgtattgaaaagtgaaatgactcacttattttgagacattttttttttgcaaatgactcggttattatgggacg 34020939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #121
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 131 - 185
Target Start/End: Complemental strand, 36203284 - 36203228
Alignment:
131 ggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacag 185  Q
    ||||||||||||||||||||||  ||| || |||||||||  |||||||||||||||    
36203284 ggaccttgcatatattatgcattgtccttatcaactgagctaagctcacgaggacag 36203228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #122
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 120 - 182
Target Start/End: Complemental strand, 37193308 - 37193244
Alignment:
120 gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgagga 182  Q
    |||||||||| |||||||||||||||||| |||  ||| ||| ||||||||  ||||||||||||    
37193308 gtttgaaccccggaccttgcatatattatacattgtccatactaactgagctaagctcacgagga 37193244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #123
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 133 - 170
Target Start/End: Complemental strand, 38416103 - 38416066
Alignment:
133 accttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||||||||||||| |||| ||||||||||||    
38416103 accttgcatatattatgcattatccttaccaactgagc 38416066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #124
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 120 - 169
Target Start/End: Complemental strand, 41521013 - 41520964
Alignment:
120 gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||||| || ||||||||||||||||||||  || ||||||||||||    
41521013 gtttgaaccttgaaccttgcatatattatgcattgtctctaccaactgag 41520964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #125
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 109 - 170
Target Start/End: Original strand, 43782296 - 43782357
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||| |||||||||||||   |||||||||||||||||||||  ||  ||||||||||||    
43782296 tggtggtcgaggtttgaaccgcagaccttgcatatattatgcattgtcattaccaactgagc 43782357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #126
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 44909895 - 44909834
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||| ||||||||||||||| || ||||||||| |||||||  ||  |||||||||||    
44909895 gtggtggctgaggtttgaaccctgaactttgcatatactatgcattgtctttaccaactgag 44909834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #127
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 115 - 152
Target Start/End: Original strand, 49953400 - 49953437
Alignment:
115 ccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||| |||||||||| ||||||||||||||||||||||    
49953400 ccgaagtttgaaccccggaccttgcatatattatgcat 49953437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #128
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 1825421 - 1825461
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||| ||||||||||||||||| ||||||||||||| ||||    
1825421 ttttgttgcaaatgactcagttgttatgggacggagagagt 1825461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #129
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 6586211 - 6586136
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagcagctcacgaggaca 184  Q
    |||||||  ||||||||||||| | ||||| |||||| |||||||  | ||||||||||||  ||||||||||||||    
6586211 gtggtggatgaggtttgaaccc-gaaccttccatatactatgcattgttcctaccaactgataagctcacgaggaca 6586136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #130
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 8294961 - 8294921
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||| |||| |||||||||||| ||||||||    
8294961 tttttttgcaaatggctcaattattatgggacagagggagt 8294921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #131
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 9196284 - 9196240
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||| ||||||  |||||||||||| |||||||||||||||    
9196284 gtggtggctgaggttcaaaccctggacctggcatatattatgcat 9196240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #132
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 9783970 - 9783926
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||||||||||||||   |||||| ||||||||||||||    
9783970 gtggtggccgaggtttgaacctcagaccttacatatattatgcat 9783926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #133
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 170
Target Start/End: Original strand, 13264272 - 13264332
Alignment:
110 ggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||| ||| |||| |||||| || ||||||||||| ||||||  |||||||||||||||||    
13264272 ggtgtccggggttcgaaccccggtccttgcatataatatgcaatatccctaccaactgagc 13264332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #134
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 131 - 184
Target Start/End: Complemental strand, 13276177 - 13276122
Alignment:
131 ggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggaca 184  Q
    ||||||||||||||||||||||  |||||||||| ||||   ||||||||||||||    
13276177 ggaccttgcatatattatgcattgtccctaccaattgagttaagctcacgaggaca 13276122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #135
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 13529798 - 13529758
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||||| |||| ||||||| |||||    
13529798 tttttttgcaaatgactcagttgttataggacggatggagt 13529758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #136
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 184
Target Start/End: Original strand, 14202480 - 14202547
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggaca 184  Q
    ||||||||||| ||||||| |||||||||||||| ||||  | ||||||||   ||||||||||||||    
14202480 ggtttgaaccccggaccttacatatattatgcattatccaaatcaactgagttaagctcacgaggaca 14202547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #137
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 109 - 169
Target Start/End: Original strand, 22630351 - 22630411
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||| || ||||||||||   |||||||||||||||||||||  || ||||||||||||    
22630351 tggtggtcggggtttgaacctcagaccttgcatatattatgcattgtcactaccaactgag 22630411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #138
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 39 - 75
Target Start/End: Original strand, 33093613 - 33093649
Alignment:
39 ggacaatatttttttgcaaatgactcagttattatgg 75  Q
    ||||||||||||||||||||||||| | |||||||||    
33093613 ggacaatatttttttgcaaatgacttacttattatgg 33093649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #139
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 35998289 - 35998329
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||| ||| ||||||||| ||||||||||||||||||||||    
35998289 ttttgttgaaaatgactccgttattatgggacggagggagt 35998329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #140
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 39974573 - 39974529
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||| |||||||||||||||  |||||| ||||||||||||||    
39974573 gtggtgtccgaggtttgaaccccagaccttccatatattatgcat 39974529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #141
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 39 - 87
Target Start/End: Complemental strand, 41436425 - 41436377
Alignment:
39 ggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||| | ||||   ||||||||||||||||||||||||||    
41436425 ggacaatatttttctacaaaaagctcagttattatgggacggagggagt 41436377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #142
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 42051829 - 42051869
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||| |||||| ||||||||||| ||||||||||||||    
42051829 tttttttacaaatggctcagttattacgggacggagggagt 42051869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #143
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 43420961 - 43420921
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||| || ||||||||| |||||||||||||||    
43420961 tttttttgcaaaagaatcagttattgtgggacggagggagt 43420921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #144
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 151
Target Start/End: Original strand, 48694651 - 48694683
Alignment:
119 ggtttgaaccctggaccttgcatatattatgca 151  Q
    ||||||||| |||||||||||||||||||||||    
48694651 ggtttgaactctggaccttgcatatattatgca 48694683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #145
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 49385296 - 49385340
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||||||||||||| | ||| ||| ||||||||||||||    
49385296 gtggtggccgaggtttgaactccggatcttacatatattatgcat 49385340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #146
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 113 - 153
Target Start/End: Original strand, 50152233 - 50152273
Alignment:
113 ggccgaggtttgaaccctggaccttgcatatattatgcatc 153  Q
    ||||| ||||||||||| | |||||||||||||||||||||    
50152233 ggccggggtttgaaccccgaaccttgcatatattatgcatc 50152273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 58; Significance: 2e-24; HSPs: 106)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 14689938 - 14689856
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||| |||||       ||||||||||||||||||||||||||||||||||||||||||||||||||    
14689938 ttgtattgaaaagtgaaatgggtcaatttttctgggacaatatttttttgcaaatgactcagttattatgggacggagggagt 14689856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 3 - 87
Target Start/End: Complemental strand, 2195448 - 2195364
Alignment:
3 tgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||||| |||||       ||||||| ||||||||||||||||||||||||||||||||||||| ||||    
2195448 tgttgtattgaaaagtgaaatgggtcaatttttttgggacaacatttttttgcaaatgactcagttattatgggacggagagagt 2195364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 2797017 - 2796935
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||||||||||        | |||||||||||||||||||| |||| |||||||||||||||||||||    
2797017 ttgtattgaaaagtgaaatgagtcaagtttttttgaacaatatttttttgcaaatggctcacttattatgggacggagggagt 2796935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 108 - 164
Target Start/End: Complemental strand, 8881346 - 8881290
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaa 164  Q
    |||||||||| ||||||||||||||||||||||||||||||||||  ||||||||||    
8881346 gtggtggccggggtttgaaccctggaccttgcatatattatgcattgtccctaccaa 8881290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 27587292 - 27587215
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||||| ||||||||||| ||||||||||||||| ||||||  ||| ||||||||||||  |||||||||||||    
27587292 gtggtggccggggtttgaaccccggaccttgcatatatcatgcattgtccttaccaactgagctaagctcacgaggac 27587215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 5 - 87
Target Start/End: Original strand, 8394647 - 8394729
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||| ||||||||||||||||||||        | |||||||||||||| |||||||||||||| |||||||||||||||||    
8394647 ttgtactgaaaagtgaaatgagtcaatttttctagaacaatatttttttgtaaatgactcagttactatgggacggagggagt 8394729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 109 - 170
Target Start/End: Original strand, 8717466 - 8717527
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||||||||||||| | ||||||||||||||||||||  ||| ||||||||||||    
8717466 tggtggccgaggtttgaaccccgaaccttgcatatattatgcattgtccataccaactgagc 8717527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 38 - 87
Target Start/End: Original strand, 10729083 - 10729131
Alignment:
38 gggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||    
10729083 gggacaatatttt-ttgcaaatgactcagttattatgggacggagggagt 10729131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 38 - 87
Target Start/End: Original strand, 38252600 - 38252649
Alignment:
38 gggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||| | |||||||||||||||||||||||||||||||||||||||||    
38252600 gggacactttttttttgcaaatgactcagttattatgggacggagggagt 38252649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 119 - 185
Target Start/End: Complemental strand, 39821944 - 39821876
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacag 185  Q
    |||||||||||  |||||||||||||||||||||  ||||||||||||||||  |||||||||||||||    
39821944 ggtttgaaccccagaccttgcatatattatgcattgtccctaccaactgagctaagctcacgaggacag 39821876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 167
Target Start/End: Complemental strand, 12748972 - 12748913
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactg 167  Q
    |||||||||| ||||||||||| ||||||||||||||||||||||  ||| |||||||||    
12748972 gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccataccaactg 12748913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 6235541 - 6235603
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||| |||||||| || ||||||| ||||||||||||||| ||| ||||||||||||    
6235541 gtggtggccggggtttgaatcccggaccttacatatattatgcatcgtccataccaactgagc 6235603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 13357431 - 13357508
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggac 183  Q
    |||||||||||||||||||||  | ||||||||||||||||||||  ||| |||||||||||   |||||||||||||    
13357431 gtggtggccgaggtttgaacctcgtaccttgcatatattatgcattgtccataccaactgagttaagctcacgaggac 13357508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 19163526 - 19163603
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    ||||||| || ||||||||||| |||||||||||| |||||||||  ||| ||||||||||||  |||||||||||||    
19163526 gtggtggtcggggtttgaaccccggaccttgcataaattatgcattgtccataccaactgagctaagctcacgaggac 19163603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 41 - 87
Target Start/End: Complemental strand, 29451290 - 29451244
Alignment:
41 acaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||||| ||||||||||||||||||| |||||    
29451290 acaatatttttttgcaaatgattcagttattatgggacggatggagt 29451244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 32051522 - 32051584
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||| ||||||||||| ||||||||||||||||||||||  |||  |||||||||||    
32051522 gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccaaaccaactgagc 32051584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 125 - 184
Target Start/End: Original strand, 33451356 - 33451417
Alignment:
125 aaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||| ||||||||||||||||||||| |||| ||||||||||||  ||||||||||||||    
33451356 aacccttgaccttgcatatattatgcattatccataccaactgagctaagctcacgaggaca 33451417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 120 - 169
Target Start/End: Complemental strand, 7553738 - 7553689
Alignment:
120 gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||||| |||||||||||||||||||||||  |||||||||||||||    
7553738 gtttgaaccttggaccttgcatatattatgcattgtccctaccaactgag 7553689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 109 - 183
Target Start/End: Complemental strand, 11709056 - 11708980
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||| || |||||||||   ||||||||||||||||||||||  ||||||||||||||||  |||||||||||||    
11709056 tggtggtcggggtttgaacttcggaccttgcatatattatgcattgtccctaccaactgagctaagctcacgaggac 11708980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 108 - 182
Target Start/End: Complemental strand, 17704084 - 17704008
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgagga 182  Q
    ||||||||||||||||||| |   |||||||||||||||||||||  ||| ||||||||||||  ||||||||||||    
17704084 gtggtggccgaggtttgaatcacagaccttgcatatattatgcattgtccttaccaactgagctaagctcacgagga 17704008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 5 - 87
Target Start/End: Original strand, 45421069 - 45421151
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||| || ||       ||||||||||||||||| ||||| ||||||| |||||| |||||||||||    
45421069 ttgtattgaaaagtgaaatgggttaatttatctgggacaatatttttttgtaaatggctcagttgttatggaacggagggagt 45421151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 8999881 - 8999960
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgca-tcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||| || |||||||||||||||| |||||||||||||||| |  || |||||||||||||  ||||||||||||||    
8999881 gtggtggtcggggtttgaaccctggactttgcatatattatgcatttgtctctaccaactgagctaagctcacgaggaca 8999960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 109 - 169
Target Start/End: Original strand, 13449788 - 13449848
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||||||||||||||||  | || |||||||||||||||||  |||||||||||||||    
13449788 tggtggccgaggtttgaacctcgaactttgcatatattatgcatggtccctaccaactgag 13449848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 39 - 87
Target Start/End: Complemental strand, 15020617 - 15020569
Alignment:
39 ggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||||||||||| ||||||||||| ||| |||||    
15020617 ggacaatatttttttgcaaatgactcacttattatgggatggatggagt 15020569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 32967448 - 32967488
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||||||||||||||||||| |||||    
32967448 tttttttgcaaatgactcagttattatgggacggatggagt 32967488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 84
Target Start/End: Original strand, 8566535 - 8566615
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttt-tttgcaaatgactcagttattatgggacggaggg 84  Q
    |||||||||||||||||||| |||||        |||||||||||| ||||||||||||| ||||||||||| ||||||||    
8566535 ttgtattgaaaagtgaaatgggtcaatttttctaggacaatattttttttgcaaatgactaagttattatggtacggaggg 8566615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 13575360 - 13575282
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||||||||||| |||||  ||| ||||||||| ||||||||  ||||||||||||||||  | ||||||||||||    
13575360 gtggtggccgaggttcgaacctcggaacttgcatatgttatgcattgtccctaccaactgagctaaactcacgaggaca 13575282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 14117444 - 14117384
Alignment:
1 aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatga 61  Q
    ||||||||||||||||||||||||||||||       |||||||||||||||| |||||||    
14117444 aatgttgtattgaaaagtgaaatgagtcaagattcttgggacaatatttttttacaaatga 14117384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 119 - 170
Target Start/End: Complemental strand, 18942978 - 18942927
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||| || ||||| |||||||||||||||| |||||||||||||||||    
18942978 ggtttgaaacccggaccatgcatatattatgcattatccctaccaactgagc 18942927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 116 - 184
Target Start/End: Original strand, 27750902 - 27750972
Alignment:
116 cgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||| |||||| |||||||||||||||||||||   ||| ||||||||||||  ||||||||||||||    
27750902 cgaggttcgaaccccggaccttgcatatattatgcactgtccttaccaactgagctaagctcacgaggaca 27750972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 109 - 152
Target Start/End: Complemental strand, 29652288 - 29652245
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||| |||||||||||| ||||||||||||||||||||||||    
29652288 tggtggtcgaggtttgaactctggaccttgcatatattatgcat 29652245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 37999409 - 37999487
Alignment:
108 gtggtggccgaggttt-gaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggac 183  Q
    |||||||||| ||||| |||||||  |||||||||||||||||||| |||| |||||||||||   |||||||||||||    
37999409 gtggtggccggggtttagaaccctataccttgcatatattatgcattatccataccaactgagttaagctcacgaggac 37999487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 115 - 170
Target Start/End: Original strand, 42208466 - 42208521
Alignment:
115 ccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||||||  ||||||||||||||||||||||  ||| ||||||||||||    
42208466 ccgaggtttgaacctcggaccttgcatatattatgcattgtccttaccaactgagc 42208521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 109 - 152
Target Start/End: Original strand, 44084263 - 44084305
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||||||||||||||||| ||||||||||||||||||||||    
44084263 tggtggccgaggtttgaaccc-ggaccttgcatatattatgcat 44084305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 444484 - 444422
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||| ||||| ||||| ||||||||||||||||||||||  ||| |||||| |||||    
444484 gtggtggccggggtttaaaccccggaccttgcatatattatgcattgtccttaccaattgagc 444422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 41 - 87
Target Start/End: Original strand, 2875251 - 2875297
Alignment:
41 acaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||| |||  |||||||||||||||||||||    
2875251 acaatatttttttgcaaatggctcgcttattatgggacggagggagt 2875297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 5179864 - 5179802
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||| |||||||||| | |||||| |||||||||||||  ||| ||||||||||||    
5179864 gtggtggccgaagtttgaaccccgaaccttgtatatattatgcattgtccttaccaactgagc 5179802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 112 - 166
Target Start/End: Original strand, 10871888 - 10871942
Alignment:
112 tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaact 166  Q
    |||||||||||||||||| |||||||||||| |||||||||  ||| ||||||||    
10871888 tggccgaggtttgaaccccggaccttgcatacattatgcattgtccataccaact 10871942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 24838160 - 24838222
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||| ||||||||||| ||||||||||||| ||||||||  |||  |||||||||||    
24838160 gtggtggccggggtttgaaccccggaccttgcatattttatgcattgtcctaaccaactgagc 24838222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 25136834 - 25136896
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||||||||||||||  ||||||||||||| |||||| |  ||| ||||||||||||    
25136834 gtggtggccgaggtttgaacctcggaccttgcatattttatgccttgtccataccaactgagc 25136896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 110 - 152
Target Start/End: Complemental strand, 44794962 - 44794920
Alignment:
110 ggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||||||||||| | ||||||||||||||||||||||    
44794962 ggtggccgaggtttgaactccggaccttgcatatattatgcat 44794920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 6447260 - 6447199
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||| ||| ||||||| | ||||||||||||||||||||||  ||| |||||||||||    
6447260 gtggtggctgagatttgaactccggaccttgcatatattatgcattgtccataccaactgag 6447199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 110 - 184
Target Start/End: Complemental strand, 13286199 - 13286124
Alignment:
110 ggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||| ||||||||||| ||| ||||||||||||||||||  ||  ||||||||||||  ||||||||||||||    
13286199 ggtggccggggtttgaaccc-ggatcttgcatatattatgcattgtctataccaactgagctaagctcacgaggaca 13286124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 129 - 170
Target Start/End: Complemental strand, 29908061 - 29908020
Alignment:
129 ctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||||||||||||||||  ||||||||||||||||    
29908061 ctggaccttgcatatattatgcattgtccctaccaactgagc 29908020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 117 - 170
Target Start/End: Complemental strand, 30427792 - 30427740
Alignment:
117 gaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||||| |||||||||||||||||||||||  ||| ||||||||||||    
30427792 gaggtttgaacc-tggaccttgcatatattatgcattgtccataccaactgagc 30427740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 119 - 168
Target Start/End: Original strand, 31336808 - 31336857
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga 168  Q
    |||||||||||| |||||||||||||||||||||  | ||||||||||||    
31336808 ggtttgaaccctagaccttgcatatattatgcattgttcctaccaactga 31336857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 87
Target Start/End: Original strand, 32231849 - 32231930
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||||||||||       ||||||||||||||||  |||||||||||  ||||||| | |||||||||    
32231849 ttgtattgaaaagtgaaatgagtcaatttttttgggacaatatttttttataaatgactcag-aattatggaatggagggagt 32231930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 38 - 87
Target Start/End: Complemental strand, 37459295 - 37459246
Alignment:
38 gggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||||||||||| ||  ||||||||||| |||||    
37459295 gggacaatatttttttgcaaatgactcaatttgtatgggacggatggagt 37459246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 121 - 169
Target Start/End: Original strand, 989580 - 989628
Alignment:
121 tttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||| ||| |||||||||||| |||| ||||||||||||||||    
989580 tttgaaccctagacattgcatatattaggcattatccctaccaactgag 989628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 39 - 87
Target Start/End: Original strand, 1494409 - 1494457
Alignment:
39 ggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||| | |||||||||||  |||||||||||||    
1494409 ggacaatatttttttgcaaaaggctcagttattacaggacggagggagt 1494457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 168
Target Start/End: Original strand, 12800890 - 12800950
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga 168  Q
    ||||||| || ||||||||||| ||||||||||||||||||| ||  ||| ||||||||||    
12800890 gtggtggtcggggtttgaaccccggaccttgcatatattatgtattgtccataccaactga 12800950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 117 - 169
Target Start/End: Complemental strand, 13105156 - 13105104
Alignment:
117 gaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||| |||||| || |||||||||||||||||||  |||||||||||||||    
13105156 gaggttcgaaccccggcccttgcatatattatgcattgtccctaccaactgag 13105104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 15001265 - 15001309
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||| |||||||||| |||||||||||||| ||||||||    
15001265 gtggtggccggggtttgaaccttggaccttgcatattttatgcat 15001309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #54
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 19260569 - 19260613
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||| ||||||||||| ||||||| ||||||||||||||    
19260569 gtggtggccggggtttgaaccccggaccttacatatattatgcat 19260613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #55
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 135 - 184
Target Start/End: Complemental strand, 23816834 - 23816783
Alignment:
135 cttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||||||||||| |||| ||||||||||||  ||||||||||||||    
23816834 cttgcatatattatgcattatccttaccaactgagctaagctcacgaggaca 23816783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #56
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 26932753 - 26932797
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||| || ||||||||||||||||||||||||||| ||||||    
26932753 gtggtggtcgtggtttgaaccctggaccttgcatatatcatgcat 26932797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #57
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 119 - 184
Target Start/End: Complemental strand, 29499831 - 29499764
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||| |||||||||||||||||||| ||||||||  ||| |||||| |||||  ||||||||||||||    
29499831 ggttcgaaccctggaccttgcatattttatgcattgtccataccaattgagctaagctcacgaggaca 29499764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #58
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 83
Target Start/End: Complemental strand, 29615731 - 29615695
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagg 83  Q
    ||||||||||||||||||| |||||||||||||||||    
29615731 tttttttgcaaatgactcatttattatgggacggagg 29615695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #59
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 30176409 - 30176453
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||| ||| ||||||||||| ||||||||||||||||||||||    
30176409 gtggtgtccggggtttgaaccccggaccttgcatatattatgcat 30176453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #60
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 36122594 - 36122550
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||| ||||||| ||||||| |||||||||||||||||||||    
36122594 gtggtggacgaggttcgaaccctagaccttgcatatattatgcat 36122550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #61
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 168
Target Start/End: Complemental strand, 37141428 - 37141368
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga 168  Q
    ||||||||||  |||||||||| | ||||||||||||||||||||  ||| ||||||||||    
37141428 gtggtggccggagtttgaaccccgaaccttgcatatattatgcattgtccataccaactga 37141368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #62
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 148
Target Start/End: Original strand, 40679719 - 40679759
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattat 148  Q
    |||||||||||||||||||||| ||||||||||||| ||||    
40679719 gtggtggccgaggtttgaaccccggaccttgcatattttat 40679759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #63
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 44790593 - 44790633
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||  ||||||||||||||||||||||||||    
44790593 tttttttgcaaatagctcagttattatgggacggagggagt 44790633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #64
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 7997011 - 7996933
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||| || |||||||||||  ||||||||||||||||||| |  ||| ||||||||||||  ||||||| ||||||    
7997011 gtggtggtcggggtttgaaccccagaccttgcatatattatgcgttgtccataccaactgagctaagctcacaaggaca 7996933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #65
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 73
Target Start/End: Original strand, 17790226 - 17790294
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattat 73  Q
    ||||||||||||||||||| ||| ||       ||||||||||||||||||||||| |||| |||||||    
17790226 ttgtattgaaaagtgaaataagtaaatttttctgggacaatatttttttgcaaatggctcaattattat 17790294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #66
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 124 - 184
Target Start/End: Complemental strand, 19778120 - 19778058
Alignment:
124 gaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||| ||||||||||||||||||||||  ||| ||||||||||||  |||||||| |||||    
19778120 gaaccccggaccttgcatatattatgcattgtccttaccaactgagctaagctcacggggaca 19778058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #67
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 53 - 87
Target Start/End: Complemental strand, 12653615 - 12653581
Alignment:
53 tgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||||||||||||| ||||    
12653615 tgcaaatgactcagttattatgggacggagagagt 12653581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #68
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 41 - 87
Target Start/End: Original strand, 14748872 - 14748918
Alignment:
41 acaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||| ||| ||||||| || |||||||||||    
14748872 acaatatttttttgcaaatggctcggttattacggaacggagggagt 14748918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #69
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 20665353 - 20665429
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||||| ||||||||| | ||||||||||||| ||||||||  | |||||||||| |||  |||||||||||||    
20665353 gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac 20665429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #70
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 22775699 - 22775622
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||||  ||||||||||| |||||||||||| |||||||||  |||  ||||||| |||  |||||||||||||    
22775699 gtggtggccagggtttgaaccccggaccttgcataaattatgcattgtccaaaccaactaagctaagctcacgaggac 22775622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #71
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 120 - 183
Target Start/End: Original strand, 27718896 - 27718961
Alignment:
120 gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||| | ||||||||||||||||||||||  ||| || |||||||||  |||||||||||||    
27718896 gtttgaactccggaccttgcatatattatgcattgtccatatcaactgagctaagctcacgaggac 27718961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #72
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 30550716 - 30550792
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||||| ||||||||| | ||||||||||||| ||||||||  | |||||||||| |||  |||||||||||||    
30550716 gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac 30550792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #73
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 33743646 - 33743584
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||| |||||||||  ||||||||||||| ||||||||  |||  |||||||||||    
33743646 gtggtggccgaagtttgaacctcggaccttgcatattttatgcattgtcctcaccaactgagc 33743584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #74
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 121 - 184
Target Start/End: Complemental strand, 37938553 - 37938488
Alignment:
121 tttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||||  |||| ||||||||||||||||| |||| ||||||||||||  | ||||||||||||    
37938553 tttgaacctcggactttgcatatattatgcattatccataccaactgagctaaactcacgaggaca 37938488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #75
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 120 - 170
Target Start/End: Original strand, 40919362 - 40919411
Alignment:
120 gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||| ||||||||||||||||||||||  | ||||||||||||||    
40919362 gtttgaaccc-ggaccttgcatatattatgcattgttcctaccaactgagc 40919411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #76
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 44215465 - 44215541
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||||| ||||||||| | ||||||||||||| ||||||||  | |||||||||| |||  |||||||||||||    
44215465 gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac 44215541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #77
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 498802 - 498741
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||| ||||||||| ||||   |||||||||||||||||||||  ||| |||||||||||    
498802 gtggtgtccgaggtttaaaccacagaccttgcatatattatgcattgtccataccaactgag 498741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #78
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 3650591 - 3650530
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||| ||||||||||| | ||||| ||||||||||||||  |  ||||||||||||    
3650591 gtggtggccggggtttgaaccccgaaccttacatatattatgcattttttctaccaactgag 3650530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #79
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 38 - 83
Target Start/End: Complemental strand, 8618074 - 8618029
Alignment:
38 gggacaatatttttttgcaaatgactcagttattatgggacggagg 83  Q
    |||||||||||||||| ||||| ||||||||||||| ||| |||||    
8618074 gggacaatatttttttacaaataactcagttattataggatggagg 8618029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #80
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 120 - 169
Target Start/End: Original strand, 12160431 - 12160480
Alignment:
120 gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||||||||||||||||||| ||||||||   |||||||||| ||||    
12160431 gtttgaaccctggaccttgcatacattatgcagtgtccctaccaagtgag 12160480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #81
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 121 - 170
Target Start/End: Original strand, 12714373 - 12714422
Alignment:
121 tttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||| | ||||||||||||||||||||  ||||| ||||||||||    
12714373 tttgaaccccgaaccttgcatatattatgcattgtcccttccaactgagc 12714422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #82
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 119 - 152
Target Start/End: Complemental strand, 33105451 - 33105418
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||||||| ||||||||||||||||||||||    
33105451 ggtttgaaccccggaccttgcatatattatgcat 33105418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #83
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 121 - 166
Target Start/End: Original strand, 33482152 - 33482197
Alignment:
121 tttgaaccctggaccttgcatatattatgcatcatccctaccaact 166  Q
    |||||||||||||||||||||| |||||||||  |||||| |||||    
33482152 tttgaaccctggaccttgcataaattatgcattgtccctatcaact 33482197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #84
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 5 - 83
Target Start/End: Complemental strand, 33743753 - 33743675
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagg 83  Q
    |||||||||||||| |||||||||||       || ||||||| | |||||||||||||||||||| |  |||||||||    
33743753 ttgtattgaaaagttaaatgagtcaatttttctggaacaatatatctttgcaaatgactcagttatcaaaggacggagg 33743675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #85
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 133 - 183
Target Start/End: Original strand, 37015851 - 37015903
Alignment:
133 accttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    ||||||||||||||||||||  || |||||||||||||  |||||||||||||    
37015851 accttgcatatattatgcattgtctctaccaactgagctaagctcacgaggac 37015903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #86
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 40167393 - 40167332
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||| |||||||| || | |||||| |||||||||||||  ||| |||||||||||    
40167393 gtggtggccggggtttgaatcccgaaccttgtatatattatgcattgtccataccaactgag 40167332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #87
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 5 - 75
Target Start/End: Original strand, 43845013 - 43845083
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgg 75  Q
    |||||||||||||||| |||||||||       ||||||||||||| ||  |||||||||| |||||||||    
43845013 ttgtattgaaaagtgatatgagtcaatttttatgggacaatattttcttataaatgactcaattattatgg 43845083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #88
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 138970 - 138930
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||| ||||||| |||||||||||||||||||| |||||    
138970 ttttttcgcaaatggctcagttattatgggacggatggagt 138930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #89
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 87
Target Start/End: Complemental strand, 2119644 - 2119612
Alignment:
55 caaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||||| |||||||||||    
2119644 caaatgactcagttattatggaacggagggagt 2119612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #90
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 2489751 - 2489707
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||||||||||||||   ||| |||||||||||||||||    
2489751 gtggtggccgaggtttgaacctcagacgttgcatatattatgcat 2489707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #91
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 6471582 - 6471538
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||| ||||||||||| | || |||||||||||||||||    
6471582 gtggtggccggggtttgaaccccgaacattgcatatattatgcat 6471538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #92
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 168
Target Start/End: Original strand, 7968931 - 7968990
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga 168  Q
    |||||||| | | ||||||||| ||||||||||||||||||||||  ||| ||||||||||    
7968931 gtggtggctgggatttgaaccc-ggaccttgcatatattatgcattgtccttaccaactga 7968990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #93
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 40 - 80
Target Start/End: Original strand, 12958345 - 12958385
Alignment:
40 gacaatatttttttgcaaatgactcagttattatgggacgg 80  Q
    |||||||||||||| |||| ||||||||||||||| |||||    
12958345 gacaatatttttttacaaaagactcagttattatgagacgg 12958385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #94
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 112 - 152
Target Start/End: Original strand, 13124357 - 13124397
Alignment:
112 tggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||| ||||||||||| ||||||||||||| ||||||||    
13124357 tggccggggtttgaaccccggaccttgcatattttatgcat 13124397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #95
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 168
Target Start/End: Complemental strand, 15020832 - 15020772
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga 168  Q
    |||||||||  ||||||||||| ||| |||||||||||||| |||  ||| ||||||||||    
15020832 gtggtggccagggtttgaaccccggatcttgcatatattatacattgtccataccaactga 15020772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #96
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Original strand, 15079167 - 15079203
Alignment:
133 accttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||||||||||||||||  |||||||||||||||    
15079167 accttgcatatattatgcattgtccctaccaactgag 15079203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #97
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 131 - 184
Target Start/End: Complemental strand, 23852959 - 23852904
Alignment:
131 ggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||||||||||||||||||  ||| |||| |||||||  ||||||||||||||    
23852959 ggaccttgcatatattatgcattgtccataccgactgagctaagctcacgaggaca 23852904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #98
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 184
Target Start/End: Original strand, 24023416 - 24023483
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||||||| ||||||||||||| ||||||||  | || || ||||||||  ||||||||||||||    
24023416 ggtttgaaccccggaccttgcatattttatgcattgttccaactaactgagctaagctcacgaggaca 24023483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #99
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 168
Target Start/End: Original strand, 24023698 - 24023758
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga 168  Q
    ||||||| || ||||||||||| |||||||||| | ||||| ||| |||| ||||||||||    
24023698 gtggtggtcggggtttgaaccccggaccttgcagacattatacattatccataccaactga 24023758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #100
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 121 - 153
Target Start/End: Original strand, 26773805 - 26773837
Alignment:
121 tttgaaccctggaccttgcatatattatgcatc 153  Q
    |||||||||| ||||||||||||||||||||||    
26773805 tttgaaccctagaccttgcatatattatgcatc 26773837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #101
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 109 - 169
Target Start/End: Complemental strand, 26799254 - 26799194
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||| || ||||| ||||| | ||||||||||| ||||||||  |||||||||||||||    
26799254 tggtggtcggggttttaaccccgaaccttgcatattttatgcattgtccctaccaactgag 26799194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #102
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 109 - 169
Target Start/End: Original strand, 29716691 - 29716751
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||  ||||||| || ||||||||||||||||||| ||  | |||||||||||||    
29716691 tggtggccggagtttgaatcccggaccttgcatatattatgaattgttcctaccaactgag 29716751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #103
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 109 - 169
Target Start/End: Complemental strand, 32421638 - 32421579
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||||| ||||||||||| ||||||||||||||||||  ||  ||| |||||||||||    
32421638 tggtggccg-ggtttgaaccccggaccttgcatatattatatattgtccataccaactgag 32421579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #104
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 33191087 - 33191127
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||| ||||||||||||||||||| |||||| ||||||||    
33191087 tttttgtgcaaatgactcagttattgtgggacagagggagt 33191127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #105
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 185
Target Start/End: Original strand, 42200652 - 42200731
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacag 185  Q
    |||||| || |||||||||||   |||| |||||||||||| |||  |||||| |||||||||  |||||||||||||||    
42200652 gtggtgaccaaggtttgaacctcagaccatgcatatattatacattgtccctatcaactgagctaagctcacgaggacag 42200731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #106
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 44615537 - 44615577
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||| |||||| ||||||||| ||||||||||||    
44615537 tttttttgcaattgactcggttattatgagacggagggagt 44615577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 56; Significance: 3e-23; HSPs: 120)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 3 - 87
Target Start/End: Original strand, 39329877 - 39329961
Alignment:
3 tgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||||||||||||        ||||||||||||||||||||||||||| |||||||||||||||||||||    
39329877 tgttgtattgaaaagtgaaatgagtcaacttttttaggacaatatttttttgcaaatgactcatttattatgggacggagggagt 39329961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 18870715 - 18870792
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    ||||||||||||||||||| | |||||||||||||||||||||||  ||||||||||||||||  |||||||||||||    
18870715 gtggtggccgaggtttgaatcatggaccttgcatatattatgcattgtccctaccaactgagctaagctcacgaggac 18870792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 5 - 87
Target Start/End: Original strand, 30261631 - 30261713
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||| |||||       ||||||||||||||||||||||| ||||||||||||||||| ||||||||    
30261631 ttgtattgaaaagtgaaatgggtcaatttttttgggacaatatttttttgcaaatggctcagttattatgggacagagggagt 30261713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 3755410 - 3755348
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||||||||| ||||||||||||||||||||||||||||  ||||||||||| ||||    
3755410 gtggtggccgaggtttaaaccctggaccttgcatatattatgcattgtccctaccaaccgagc 3755348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 39 - 87
Target Start/End: Complemental strand, 9218089 - 9218041
Alignment:
39 ggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||    
9218089 ggacaatatttttttgcaaatgactcagttattacgggacggagggagt 9218041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 10498685 - 10498763
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||||||||||||| |  |||||||||||||||||||||  ||| ||||||||||||  ||||||||||||||    
10498685 gtggtggccgaggtttgaactcatgaccttgcatatattatgcattgtccataccaactgagctaagctcacgaggaca 10498763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 119 - 169
Target Start/End: Complemental strand, 552234 - 552184
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||||||||||||||||||||||||||  ||||||||||||||||    
552234 ggtttgaaccctggaccttgcatatattatgcaatatccctaccaactgag 552184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 41 - 87
Target Start/End: Original strand, 38600970 - 38601016
Alignment:
41 acaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||    
38600970 acaatttttttttgcaaatgactcagttattatgggacggagggagt 38601016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 45432019 - 45431957
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||  ||||||||||| ||||||||||||||||||||||  ||||||||||||||||    
45432019 gtggtggccagggtttgaaccccggaccttgcatatattatgcattgtccctaccaactgagc 45431957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 38 - 87
Target Start/End: Complemental strand, 1923040 - 1922991
Alignment:
38 gggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||| |||||||||| ||||||||||||||||||||||||||    
1923040 gggacaatatttctttgcaaatggctcagttattatgggacggagggagt 1922991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 108 - 182
Target Start/End: Original strand, 25340914 - 25340990
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgagga 182  Q
    |||||||||| ||||||||||| ||||||||||||| ||||||||  ||| ||||||||||||  ||||||||||||    
25340914 gtggtggccggggtttgaaccccggaccttgcatattttatgcattgtccataccaactgagctaagctcacgagga 25340990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 38130949 - 38131010
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||| ||||||||||| ||||||||||||||||||||||  ||| |||||||||||    
38130949 gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccataccaactgag 38131010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 3 - 84
Target Start/End: Original strand, 42547233 - 42547315
Alignment:
3 tgttgtattgaaaagtgaaatgagtcaannnnnnngggacaata-tttttttgcaaatgactcagttattatgggacggaggg 84  Q
    ||||||||||||||||||||||||||||       ||||||||| |||||||||| |||||||||||||||||| | ||||||    
42547233 tgttgtattgaaaagtgaaatgagtcaatttttttgggacaatattttttttgcagatgactcagttattatggaatggaggg 42547315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 5 - 87
Target Start/End: Original strand, 46194335 - 46194417
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||| |||||       |||||||||||||| || ||||| ||||||| ||||||||||||||||||    
46194335 ttgtattgaaaagtgaaatgggtcaatttttctgggacaatatttttctgaaaatggctcagttgttatgggacggagggagt 46194417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 121 - 183
Target Start/End: Original strand, 48315027 - 48315091
Alignment:
121 tttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    ||||||||| |||||||||||||||||||||| |||| ||||||||||||  |||||||||||||    
48315027 tttgaaccccggaccttgcatatattatgcattatccttaccaactgagctaagctcacgaggac 48315091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 51882190 - 51882251
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||| ||||||||||||||| ||||||||||||||||||  ||| |||||||||||    
51882190 gtggtggccggggtttgaaccctggatcttgcatatattatgcattgtccataccaactgag 51882251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 53754190 - 53754276
Alignment:
1 aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||| |||||||||||||       | ||||||| ||||||  ||||||||||||||||||||||||||| ||||    
53754190 aatgttgtattgaaaactgaaatgagtcaagattactgtgacaataattttttataaatgactcagttattatgggacggagcgagt 53754276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 1334946 - 1334986
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||||||||||||||||||||||||    
1334946 tttttttgcaaatgactcagttattatgggacggagggagt 1334986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 171
Target Start/End: Original strand, 8136622 - 8136685
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagca 171  Q
    ||||||| || |||||||||| |||||||||||||||||||||||| ||| ||||||| |||||    
8136622 gtggtggtcggggtttgaaccttggaccttgcatatattatgcatcgtccataccaaccgagca 8136685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 16792964 - 16793042
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||| ||| ||||||||||||||||||||||||||||||||||  ||  ||||||||| ||  ||||||||||||||    
16792964 gtggtgaccggggtttgaaccctggaccttgcatatattatgcattgtctataccaactgtgctaagctcacgaggaca 16793042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 180
Target Start/End: Complemental strand, 27185548 - 27185474
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgag 180  Q
    ||||||| ||||||||||||||  |||||||||||||||||| ||  ||||||||||||||||  ||||||||||    
27185548 gtggtggtcgaggtttgaaccccagaccttgcatatattatgtattgtccctaccaactgagctaagctcacgag 27185474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 112 - 184
Target Start/End: Original strand, 43777051 - 43777124
Alignment:
112 tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||||||||||| | ||||||||||||||||||||  ||||||||||||||||  ||||||||| ||||    
43777051 tggccgaggtttgaaccc-gaaccttgcatatattatgcatggtccctaccaactgagctaagctcacgaagaca 43777124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 48409566 - 48409482
Alignment:
1 aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggaggga 85  Q
    |||||||||||||||| ||||||| |||||        ||||||||||||||| |||||| ||||||||||| ||||||||||||    
48409566 aatgttgtattgaaaactgaaatgggtcaagattcctaggacaatatttttttacaaatggctcagttattacgggacggaggga 48409482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 114 - 168
Target Start/End: Original strand, 759590 - 759644
Alignment:
114 gccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga 168  Q
    |||||||||||||||||| || |||||||||||||||||  ||||||||||||||    
759590 gccgaggtttgaaccctgaactttgcatatattatgcattgtccctaccaactga 759644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 119 - 186
Target Start/End: Original strand, 1149070 - 1149139
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacaga 186  Q
    |||| ||||||| |||||||||||||||||||||  ||| ||||||||||||  ||||||||||||||||    
1149070 ggttcgaaccctagaccttgcatatattatgcattgtccttaccaactgagctaagctcacgaggacaga 1149139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 7464481 - 7464558
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggac 183  Q
    ||||||| || ||||||||||| ||||||| ||||||||||||||  |||||||||||||||   |||||||||||||    
7464481 gtggtggtcggggtttgaaccccggaccttacatatattatgcattgtccctaccaactgagttaagctcacgaggac 7464558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 119 - 169
Target Start/End: Original strand, 16663237 - 16663287
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||||||| |||||||||||||||||||||| |||| |||||||||||    
16663237 ggtttgaaccccggaccttgcatatattatgcattatccataccaactgag 16663287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 25441490 - 25441552
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||| |||||||||||  |||||||||||||||||||||  ||| ||||||||||||    
25441490 gtggtggccggggtttgaaccccagaccttgcatatattatgcattgtccataccaactgagc 25441552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 109 - 184
Target Start/End: Complemental strand, 34899167 - 34899090
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||| || ||||||||||| ||||||||||||||||||||||  ||||||| ||||||||  || |||||||||||    
34899167 tggtggtcggggtttgaaccccggaccttgcatatattatgcattgtccctacgaactgagctaagatcacgaggaca 34899090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 35863803 - 35863865
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||||||||||||||  |||||||||||||||||| ||  ||| ||||||||||||    
35863803 gtggtggccgaggtttgaaccccagaccttgcatatattatgtattgtccttaccaactgagc 35863865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 108 - 186
Target Start/End: Original strand, 32843252 - 32843332
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacaga 186  Q
    |||||||||| |||||||||||  |||||||||||| ||||||||  |||  |||||||||||  ||||||||||||||||    
32843252 gtggtggccggggtttgaaccccagaccttgcatattttatgcattgtccaaaccaactgagctaagctcacgaggacaga 32843332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 38 - 87
Target Start/End: Complemental strand, 47496122 - 47496073
Alignment:
38 gggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||| ||||||||||||||||||  |||||||||||||    
47496122 gggacaatatttttttacaaatgactcagttattacaggacggagggagt 47496073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 913590 - 913634
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||| ||||||||||||| ||||||||||||||||||||||    
913590 gtggtggcagaggtttgaaccccggaccttgcatatattatgcat 913634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 48849753 - 48849797
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||| ||||||||||| ||||||||||||||||||||||    
48849753 gtggtggccggggtttgaaccccggaccttgcatatattatgcat 48849797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 7557524 - 7557602
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggaca 184  Q
    |||||||||||||||||| | | |||||||||||| |||||||||  ||| |||||||||||   ||||||||||||||    
7557524 gtggtggccgaggtttgatcgccggaccttgcatacattatgcattgtccataccaactgagttaagctcacgaggaca 7557602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 10926540 - 10926462
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||||  ||||||||| | ||||||||||||||||||||  ||| ||||||||||||  |||| |||||||||    
10926540 gtggtggccgacatttgaaccccgaaccttgcatatattatgcattgtccttaccaactgagctaagcttacgaggaca 10926462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 119 - 174
Target Start/End: Original strand, 27065733 - 27065788
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagcagct 174  Q
    ||||||||||||||||||||||||| ||||||||  |||| ||||||||| |||||    
27065733 ggtttgaaccctggaccttgcatattttatgcattgtcccaaccaactgatcagct 27065788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 111 - 170
Target Start/End: Original strand, 38034802 - 38034861
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||||||||||| ||||||||||||| ||||| ||  |||| |||||||||||    
38034802 gtggccgaggtttgaaccccggaccttgcatattttatgtattgtcccaaccaactgagc 38034861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 166
Target Start/End: Complemental strand, 10102870 - 10102812
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaact 166  Q
    |||||||||| |||||||||||||||  |||||| ||||||||||  ||||||||||||    
10102870 gtggtggccggggtttgaaccctggattttgcatgtattatgcattgtccctaccaact 10102812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 166
Target Start/End: Complemental strand, 10213793 - 10213735
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaact 166  Q
    |||||||||| |||||||||||||||  |||||| ||||||||||  ||||||||||||    
10213793 gtggtggccggggtttgaaccctggattttgcatgtattatgcattgtccctaccaact 10213735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 119 - 169
Target Start/End: Original strand, 10922309 - 10922359
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||||||| ||| ||||||||||||||||||  |||||||||||||||    
10922309 ggtttgaaccccggatcttgcatatattatgcattgtccctaccaactgag 10922359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 121 - 184
Target Start/End: Original strand, 16980357 - 16980422
Alignment:
121 tttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||| || ||||||||||||||||||||  ||| ||||||||||||  ||||||||||||||    
16980357 tttgaaccatgaaccttgcatatattatgcattgtccttaccaactgagctaagctcacgaggaca 16980422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 29631257 - 29631195
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||| |||||||| || | ||||||||||||||||||||  ||| ||||||||||||    
29631257 gtggtggccggggtttgaatcccgaaccttgcatatattatgcattgtccataccaactgagc 29631195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 150
Target Start/End: Original strand, 35210121 - 35210163
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgc 150  Q
    |||||||||||||||||||||| ||||||||||||| ||||||    
35210121 gtggtggccgaggtttgaaccccggaccttgcatattttatgc 35210163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 8 - 87
Target Start/End: Complemental strand, 39143737 - 39143658
Alignment:
8 tattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||||||       |  |||||||||||| ||||||| ||||  ||||||||||||||||||||    
39143737 tattgaaaagtgaaatgagtcaatttttttgaaacaatattttttggcaaatggctcacctattatgggacggagggagt 39143658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 119 - 186
Target Start/End: Complemental strand, 44579696 - 44579627
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacaga 186  Q
    |||| |||||| ||||||||||||| ||||||||  ||| ||||||||||||  ||||||||||||||||    
44579696 ggttcgaaccccggaccttgcatattttatgcattgtccataccaactgagctaagctcacgaggacaga 44579627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 55066590 - 55066652
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||| | |||||||||  |||| |||||||||||||||| |||| ||||||||||||    
55066590 gtggtggccgggatttgaaccccagaccatgcatatattatgcattatccgtaccaactgagc 55066652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 4601915 - 4601854
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||| ||||||||||| ||||||||||| ||||||||||  |||  ||||||||||    
4601915 gtggtggccggggtttgaaccccggaccttgcatttattatgcattgtccaaaccaactgag 4601854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 115 - 152
Target Start/End: Original strand, 5428433 - 5428470
Alignment:
115 ccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||||| |||||||||||||||||||||||||    
5428433 ccgaggtttgaatcctggaccttgcatatattatgcat 5428470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 122 - 184
Target Start/End: Complemental strand, 7738726 - 7738662
Alignment:
122 ttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggaca 184  Q
    |||||||| ||||||||||||| ||||||||  |||||||||||||||   ||||||||||||||    
7738726 ttgaaccccggaccttgcatattttatgcattgtccctaccaactgagttaagctcacgaggaca 7738662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 39100073 - 39100118
Alignment:
108 gtggtggccgaggtttgaaccct-ggaccttgcatatattatgcat 152  Q
    ||||||||||||||||||||| | ||||||||||||||||||||||    
39100073 gtggtggccgaggtttgaaccatcggaccttgcatatattatgcat 39100118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 38 - 83
Target Start/End: Complemental strand, 41286991 - 41286947
Alignment:
38 gggacaatatttttttgcaaatgactcagttattatgggacggagg 83  Q
    ||||||||||||||| |||||||||||| |||||||||||||||||    
41286991 gggacaatatttttt-gcaaatgactcatttattatgggacggagg 41286947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 45746343 - 45746261
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||| |||||| ||||||       | |||||||||||||||||||||| ||||||||||||  |||||| ||||    
45746343 ttgtattgaaaactgaaataagtcaatttttttgtgacaatatttttttgcaaatgaatcagttattatgaaacggagagagt 45746261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 120 - 169
Target Start/End: Complemental strand, 46903967 - 46903918
Alignment:
120 gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||||||||||| ||||||||||||||  ||| |||||||||||    
46903967 gtttgaaccctggaccttacatatattatgcattgtccataccaactgag 46903918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 109 - 170
Target Start/End: Complemental strand, 52119446 - 52119385
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||| |||| |||||| | ||||||||||||||||||||  ||| ||||||||||||    
52119446 tggtggccggggttcgaaccccgaaccttgcatatattatgcattgtccttaccaactgagc 52119385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 54243456 - 54243395
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||||||||||||||| ||| |||  |||||||||||||| | | |||||||||||    
54243456 gtggtggccgaggtttgaaccccggatcttaaatatattatgcatcgtgcttaccaactgag 54243395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 334837 - 334881
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||| ||||||||||| ||||||||||||| ||||||||    
334837 gtggtggccggggtttgaaccccggaccttgcatattttatgcat 334881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 2453884 - 2453840
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||||||||||| |||||||  ||||||||||||||||||||    
2453884 gtggtggccgaggttcgaaccctaaaccttgcatatattatgcat 2453840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 32023271 - 32023311
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||| ||||||||||||||||||||| |||||||    
32023271 tttttttgcaattgactcagttattatgggacgaagggagt 32023311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 121 - 169
Target Start/End: Original strand, 35126272 - 35126320
Alignment:
121 tttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||  || |||||||||||||||||| ||||||||||||||||    
35126272 tttgaaccccagatcttgcatatattatgcattatccctaccaactgag 35126320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 38603029 - 38602985
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||| |||||||||| || ||||||||||||||||||||    
38603029 gtggtggccggggtttgaaccatgaaccttgcatatattatgcat 38602985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 43640742 - 43640782
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||| |||||||||||||||||| ||||||||    
43640742 tttttttgcaaataactcagttattatgggacagagggagt 43640782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 44582796 - 44582717
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcata-tattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| |||| |||||| |||||||||||| ||||||||||   || ||||||||||||  ||||||||||||||    
44582796 gtggtggccggggttcgaaccccggaccttgcatattattatgcattgcccataccaactgagctgagctcacgaggaca 44582717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 112 - 152
Target Start/End: Original strand, 48656893 - 48656933
Alignment:
112 tggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||| ||||||||||||| ||||||||||||||||||||||    
48656893 tggctgaggtttgaaccccggaccttgcatatattatgcat 48656933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 51164885 - 51164845
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||| || |||||||||||||||||||||||    
51164885 tttttttgcaaatggctgagttattatgggacggagggagt 51164845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 3100292 - 3100214
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| ||||  |||||||||| |||||||| ||||||||  |||  |||||||||||  ||||||||||||||    
3100292 gtggtggccggggttcaaaccctggactttgcatatgttatgcattgtccacaccaactgagctaagctcacgaggaca 3100214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 120 - 184
Target Start/End: Original strand, 4332669 - 4332735
Alignment:
120 gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| |||||||| ||||||||||||| || |  |||||||||||  ||||||||||||||    
4332669 gtttgaaccccggaccttggatatattatgcattattcaaaccaactgagctaagctcacgaggaca 4332735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 109 - 168
Target Start/End: Complemental strand, 10594747 - 10594688
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga 168  Q
    ||||| || |||||||||||||  ||||||||||||||||||||  ||| ||||||||||    
10594747 tggtgtccaaggtttgaaccctaaaccttgcatatattatgcattgtccttaccaactga 10594688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 180
Target Start/End: Complemental strand, 14827596 - 14827522
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgag 180  Q
    |||||||||| ||||| ||||| ||| ||||||||| ||||||||  ||| ||||||||||||  ||||||||||    
14827596 gtggtggccggggtttaaaccccggatcttgcatattttatgcattgtccataccaactgagctaagctcacgag 14827522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 119 - 170
Target Start/End: Complemental strand, 17218551 - 17218500
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||| || ||||||||||| ||||||  |||||||||||||||||    
17218551 ggtttgaaccccggcccttgcatataatatgcaatatccctaccaactgagc 17218500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 47 - 82
Target Start/End: Original strand, 21296680 - 21296715
Alignment:
47 tttttttgcaaatgactcagttattatgggacggag 82  Q
    ||||||||||||||||||||||||| ||||||||||    
21296680 tttttttgcaaatgactcagttattgtgggacggag 21296715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 21331407 - 21331485
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||| ||||||| || |||||| | ||||||||||||||||||||  ||| || |||||||||  ||||||||||||||    
21331407 gtggcggccgagattcgaaccccgaaccttgcatatattatgcattgtccataacaactgagctaagctcacgaggaca 21331485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #73
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 120 - 184
Target Start/End: Original strand, 21628890 - 21628956
Alignment:
120 gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| |||| ||| ||||||||||||| ||||  |||||||||||  ||||||||||||||    
21628890 gtttgaaccccggacgttggatatattatgcattatccaaaccaactgagctaagctcacgaggaca 21628956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #74
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 48 - 87
Target Start/End: Original strand, 24619086 - 24619125
Alignment:
48 ttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||||| |||| ||||||||||||    
24619086 ttttttgcaaatgactcagttagtatgagacggagggagt 24619125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #75
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 32629151 - 32629073
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||| ||| ||| |||||| ||||||||||||| ||||||||  ||| ||||||||||||  |||||||| |||||    
32629151 gtggtggtcgatgttcgaaccccggaccttgcatattttatgcattgtccataccaactgagctaagctcacgtggaca 32629073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #76
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 36483747 - 36483669
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| |||| ||||||  | ||||| |||||||||||||  ||||| ||||||||||  ||||||||||||||    
36483747 gtggtggccggggttcgaacccaaggccttgtatatattatgcattgtccctgccaactgagcaaagctcacgaggaca 36483669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #77
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 131 - 170
Target Start/End: Complemental strand, 48511298 - 48511259
Alignment:
131 ggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||||||||||||||  ||||||||||||||||    
48511298 ggaccttgcatatattatgcattgtccctaccaactgagc 48511259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #78
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 47 - 82
Target Start/End: Complemental strand, 48744161 - 48744126
Alignment:
47 tttttttgcaaatgactcagttattatgggacggag 82  Q
    |||||||||||||| |||||||||||||||||||||    
48744161 tttttttgcaaatggctcagttattatgggacggag 48744126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #79
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 40 - 87
Target Start/End: Original strand, 50150531 - 50150578
Alignment:
40 gacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||||||| || ||||||||| | |||||||||    
50150531 gacaatatttttttgcaaatgacccacttattatggaatggagggagt 50150578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #80
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 124 - 184
Target Start/End: Original strand, 53633623 - 53633685
Alignment:
124 gaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggaca 184  Q
    |||||| ||||||| |||||||||||||| |||| |||||||||||   ||||||||||||||    
53633623 gaaccccggaccttacatatattatgcattatccttaccaactgagttaagctcacgaggaca 53633685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #81
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 53996370 - 53996292
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| | || ||||||  |||||||||||||||||||||  ||| ||||||||||||  ||||||| ||||||    
53996370 gtggtggccgggattcgaaccccagaccttgcatatattatgcattgtccataccaactgagctaagctcacaaggaca 53996292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #82
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 916510 - 916434
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||||| ||||||||| | ||||||||||||| ||||||||  | |||||||||| |||  |||||||||||||    
916510 gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac 916434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #83
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 11358305 - 11358243
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||| ||||||||||| ||| ||||||||||||||| ||  || |||||||| ||||    
11358305 gtggtggccggggtttgaaccccggatcttgcatatattatgaattgtcgctaccaaccgagc 11358243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #84
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 109 - 159
Target Start/End: Original strand, 21567678 - 21567728
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccct 159  Q
    ||||||| || |||||||||||| ||||||||||||||||| || ||||||    
21567678 tggtggctgaagtttgaaccctgaaccttgcatatattatgtattatccct 21567728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #85
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 87
Target Start/End: Original strand, 36097829 - 36097867
Alignment:
49 tttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||||||||| ||||||| ||||    
36097829 tttttgcaaatgactcagttattatgagacggagtgagt 36097867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #86
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 169
Target Start/End: Complemental strand, 41817559 - 41817509
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||||||| ||||||||||||||||||||||  |||  ||||||||||    
41817559 ggtttgaaccccggaccttgcatatattatgcattgtccaaaccaactgag 41817509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #87
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 48796208 - 48796285
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||||| ||||||||||| | ||||||||||| ||||||||  |||  || ||||||||  |||||||||||||    
48796208 gtggtggccggggtttgaaccccgaaccttgcatatcttatgcattgtccaaactaactgagctaagctcacgaggac 48796285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #88
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 121 - 170
Target Start/End: Original strand, 977944 - 977993
Alignment:
121 tttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||| | ||||||||||||||||||||||  ||| ||||||||||||    
977944 tttgaactccggaccttgcatatattatgcattgtccataccaactgagc 977993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #89
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 3176964 - 3177024
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||| ||||| ||||| | ||||||||||||||||||||  | |||||||||||||    
3176964 gtggtggccgtggtttaaacccag-accttgcatatattatgcattgttcctaccaactgag 3177024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #90
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 42 - 87
Target Start/End: Original strand, 17777146 - 17777191
Alignment:
42 caatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||| ||||||||||||| ||||| ||||||||||| |||||||||    
17777146 caatttttttttgcaaattactcaattattatgggatggagggagt 17777191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #91
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 42 - 87
Target Start/End: Original strand, 19078447 - 19078492
Alignment:
42 caatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||| ||||||||||||| ||||| ||||||||||| |||||||||    
19078447 caatttttttttgcaaattactcaattattatgggatggagggagt 19078492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #92
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 111 - 152
Target Start/End: Complemental strand, 20018265 - 20018224
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||||||||||||  |||||||||||| ||||||||    
20018265 gtggccgaggtttgaaccccagaccttgcatattttatgcat 20018224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #93
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 20079793 - 20079732
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||||||||||||||| | |||| |||||||||||||| |||  || |||| |||||||    
20079793 gtggtggccgaggtttgaatcttggatcttgcatatattatacattgtctctactaactgag 20079732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #94
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 186
Target Start/End: Complemental strand, 22722473 - 22722393
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacaga 186  Q
    ||||||| || ||||||||||  ||||||||||||| ||||||||  | | ||| ||||||||  ||||||||||||||||    
22722473 gtggtggtcggggtttgaacctcggaccttgcatattttatgcattgttcatactaactgagctaagctcacgaggacaga 22722393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #95
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 112 - 186
Target Start/End: Original strand, 27999691 - 27999767
Alignment:
112 tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacaga 186  Q
    |||||| |||||||||||  ||| ||||||| | || |||| |||| ||||||||||||  ||||||||||||||||    
27999691 tggccggggtttgaaccccagactttgcatacaatacgcattatccataccaactgagctaagctcacgaggacaga 27999767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #96
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 32909291 - 32909352
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||| | ||||||||| ||||||||||||| ||||||||  ||| ||| |||||||    
32909291 gtggtggccgggatttgaacccaggaccttgcatattttatgcattgtccatactaactgag 32909352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #97
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 119 - 185
Target Start/End: Original strand, 35191818 - 35191886
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacag 185  Q
    |||| ||||||  |||||||||||||||||||||  ||| ||||||||||||  ||| |||||||||||    
35191818 ggttcgaaccccagaccttgcatatattatgcattgtccttaccaactgagctaagcgcacgaggacag 35191886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #98
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 111 - 152
Target Start/End: Original strand, 35347288 - 35347329
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||| ||||||||||||||  |||||||||||||||||||||    
35347288 gtggtcgaggtttgaaccccagaccttgcatatattatgcat 35347329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #99
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 121 - 170
Target Start/End: Complemental strand, 36431867 - 36431818
Alignment:
121 tttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||  ||| ||||||||||||| ||| |||||||||||||||||    
36431867 tttgaaccccagacattgcatatattatacattatccctaccaactgagc 36431818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #100
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 38 - 87
Target Start/End: Original strand, 39365179 - 39365228
Alignment:
38 gggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||| | |||||| | ||||| ||||||||||||||||||||||||||    
39365179 gggacacttttttttggtaaatggctcagttattatgggacggagggagt 39365228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #101
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 40520823 - 40520762
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||| || |||||||||  |||||||||||||| |||||||| |||| ||| |||||||    
40520823 gtggtggtcggggtttgaactttggaccttgcatattttatgcattatccatacaaactgag 40520762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #102
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 111 - 152
Target Start/End: Original strand, 42886502 - 42886543
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||||||||||||||| | ||||||||||| ||||||||    
42886502 gtggccgaggtttgaaccccgaaccttgcatattttatgcat 42886543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #103
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 109 - 170
Target Start/End: Original strand, 45885468 - 45885529
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||| ||||||||||   ||||||||||||||||||||   ||| ||||||||||||    
45885468 tggtggccggggtttgaacctcagaccttgcatatattatgcaaggtccataccaactgagc 45885529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #104
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 168
Target Start/End: Original strand, 1456530 - 1456590
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga 168  Q
    |||||||||||| ||||||||   ||||||||||||||||| |||  |||||| |||||||    
1456530 gtggtggccgagttttgaacctcagaccttgcatatattatacattgtccctatcaactga 1456590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #105
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 168
Target Start/End: Original strand, 1743980 - 1744040
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga 168  Q
    ||||||||||| ||| |||||| | ||||||||||||||||| ||  ||| ||||||||||    
1743980 gtggtggccgaagttcgaaccccgaaccttgcatatattatgtattgtccataccaactga 1744040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #106
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 170
Target Start/End: Complemental strand, 2445582 - 2445522
Alignment:
110 ggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||| |||||||||||| ||||||| | |||||||| |||  ||| ||||||||||||    
2445582 ggtggcctaggtttgaaccccggacctttcgtatattatacattgtccttaccaactgagc 2445522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #107
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 4825410 - 4825366
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||| ||||||| |||||| ||||||| ||||||||||||||    
4825410 gtggtggtcgaggttcgaaccccggacctttcatatattatgcat 4825366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #108
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 135 - 184
Target Start/End: Original strand, 7974529 - 7974580
Alignment:
135 cttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||||||||||| |||| ||||||||||||  ||||||||| ||||    
7974529 cttgcatatattatgcattatccataccaactgagctaagctcacgacgaca 7974580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #109
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 8075856 - 8075812
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||| ||||||||||   |||||||||||||||||||||    
8075856 gtggtggccggggtttgaacctcagaccttgcatatattatgcat 8075812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #110
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 8238635 - 8238591
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||||||  ||||||||||  |||||||||||||||||||||    
8238635 gtggtggccggagtttgaaccccagaccttgcatatattatgcat 8238591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #111
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 118 - 170
Target Start/End: Original strand, 11250597 - 11250649
Alignment:
118 aggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||| |||||| ||||| |||||||| ||||||  |||||||||||||||||    
11250597 aggttcgaaccccggaccctgcatataatatgcaatatccctaccaactgagc 11250649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #112
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 116 - 148
Target Start/End: Original strand, 17476745 - 17476777
Alignment:
116 cgaggtttgaaccctggaccttgcatatattat 148  Q
    ||||||||||||||| |||||||||||||||||    
17476745 cgaggtttgaaccctagaccttgcatatattat 17476777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #113
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 22251450 - 22251494
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||| |||| |||||| ||||| ||||||||||||||||    
22251450 gtggtggccggggttcgaaccccggaccgtgcatatattatgcat 22251494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #114
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 185
Target Start/End: Original strand, 22799716 - 22799795
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacag 185  Q
    ||||||| |||||||||||||  ||||||||||| | ||||||||  ||| ||| ||||||||   ||||||||||||||    
22799716 gtggtggtcgaggtttgaacctcggaccttgcatgttttatgcattgtccttacaaactgagctatgctcacgaggacag 22799795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #115
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 25727957 - 25728001
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||| || | ||||||||| ||||||||||||||||||||||    
25727957 gtggtggtcgggatttgaaccccggaccttgcatatattatgcat 25728001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #116
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 124 - 168
Target Start/End: Complemental strand, 28266771 - 28266727
Alignment:
124 gaaccctggaccttgcatatattatgcatcatccctaccaactga 168  Q
    |||||| ||||||||||||||||||||||  ||| ||||||||||    
28266771 gaaccccggaccttgcatatattatgcattgtccttaccaactga 28266727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #117
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 148
Target Start/End: Complemental strand, 32651715 - 32651675
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattat 148  Q
    ||||| ||||||||||||||| || ||||||||||||||||    
32651715 gtggttgccgaggtttgaaccatgaaccttgcatatattat 32651675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #118
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 44075146 - 44075190
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||| ||||||||| | ||||||||||||| ||||||||    
44075146 gtggtggccggggtttgaactccggaccttgcatattttatgcat 44075190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #119
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 44234026 - 44233986
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||| |||||||||| || ||||||||    
44234026 tttttttgcaaatgactctgttattatggaacagagggagt 44233986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #120
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 184
Target Start/End: Original strand, 52904144 - 52904211
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||||  ||| |||||||||||||||||  ||| ||||||||||||  | ||||||||||||    
52904144 ggtttgaacccccgacattgcatatattatgcattgtccttaccaactgagctaacctcacgaggaca 52904211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 55; Significance: 1e-22; HSPs: 132)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 10735821 - 10735898
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||||  |||||||||||||    
10735821 gtggtggccggggtttgaaccccggaccttgcatatattatgcatcgtccctaccaactgagctaagctcacgaggac 10735898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 13222046 - 13221965
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||| |||||       ||||||||||||||||||||||||||||||||||||||||||||||||||    
13222046 ttgtattgaaaagtgaaatg-gtcaatttttatgggacaatatttttttgcaaatgactcagttattatgggacggagggagt 13221965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 35820291 - 35820368
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||  ||||||||||||||||  |||||||||||||    
35820291 gtggtggccgaggtttgaaccccggaccttgcatgtattatgcattgtccctaccaactgagctaagctcacgaggac 35820368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 314413 - 314331
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||||  ||||        |||||||||||||||||||||||||||||||||||||||||| ||||||    
314413 ttgtattgaaaagtgaaatggatcaatttttctaggacaatatttttttgcaaatgactcagttattatgggacggggggagt 314331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 5425835 - 5425753
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||||| ||        ||||||||||||||||||||||| |||| |||||||||||||||||||||    
5425835 ttgtattgaaaagtgaaatgagacagttttcttgggacaatatttttttgcaaatggctcacttattatgggacggagggagt 5425753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 109 - 170
Target Start/End: Complemental strand, 30089119 - 30089058
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||||||||||||| |||||||| |||||||||||||  ||||||||||||||||    
30089119 tggtggccgaggtttgaaccccggaccttgtatatattatgcattgtccctaccaactgagc 30089058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 109 - 170
Target Start/End: Complemental strand, 30125723 - 30125662
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||||||||||||| |||||||| |||||||||||||  ||||||||||||||||    
30125723 tggtggccgaggtttgaaccccggaccttgtatatattatgcattgtccctaccaactgagc 30125662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 31348489 - 31348407
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||| ||||||| |||||        |||||||||||||||||||||| ||||||||||||||||||||||||||    
31348489 ttgtattgaaaattgaaatgggtcaatttttctaggacaatatttttttgcaaatggctcagttattatgggacggagggagt 31348407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 5 - 75
Target Start/End: Complemental strand, 31592529 - 31592459
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgg 75  Q
    ||||||||||||||||||||||||||       ||||||||||| ||||||||||||||||||||||||||    
31592529 ttgtattgaaaagtgaaatgagtcaatttttttgggacaatattattttgcaaatgactcagttattatgg 31592459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 3 - 81
Target Start/End: Complemental strand, 44260554 - 44260476
Alignment:
3 tgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacgga 81  Q
    ||||||||||||||||||||||| ||||       | |||||||||||||||||||||| |||||||||||||||||||    
44260554 tgttgtattgaaaagtgaaatgaatcaacttttttgagacaatatttttttgcaaatgattcagttattatgggacgga 44260476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 39 - 81
Target Start/End: Complemental strand, 2427301 - 2427259
Alignment:
39 ggacaatatttttttgcaaatgactcagttattatgggacgga 81  Q
    |||||||||||||||||||||||||||||||||||||||||||    
2427301 ggacaatatttttttgcaaatgactcagttattatgggacgga 2427259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 24592836 - 24592898
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||| |||||||||||  |||||||||||||||||||||  ||||||||||||||||    
24592836 gtggtggccggggtttgaaccccagaccttgcatatattatgcattgtccctaccaactgagc 24592898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 29544698 - 29544636
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||| ||||||||||| ||||||||||||||||||||||  |||||||||| |||||    
29544698 gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccctaccaattgagc 29544636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 38 - 87
Target Start/End: Original strand, 6685831 - 6685880
Alignment:
38 gggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||    
6685831 gggacaatatttttttgcaaatcactccgttattatgggacggagggagt 6685880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 46 - 87
Target Start/End: Original strand, 20696951 - 20696992
Alignment:
46 atttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||||||||||||||||||||||||||    
20696951 atttttttgcaaatgactcagttattatgggacggagggagt 20696992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 31815877 - 31815938
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||| || ||||||||||| ||||||||||||||||||||||  |||||||||||||||    
31815877 gtggtggtcggggtttgaaccccggaccttgcatatattatgcattgtccctaccaactgag 31815938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 20200776 - 20200732
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||| ||||||||||||||||||||||||||||||||||    
20200776 gtggtggccggggtttgaaccctggaccttgcatatattatgcat 20200732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 119 - 180
Target Start/End: Original strand, 20565076 - 20565139
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgag 180  Q
    ||||||||||| ||||||||||||||||||||||  ||||||||||||||||  ||||||||||    
20565076 ggtttgaaccccggaccttgcatatattatgcattgtccctaccaactgagctaagctcacgag 20565139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 119 - 184
Target Start/End: Complemental strand, 31543072 - 31543005
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||||||| |||||||||||||||||||||| |||| ||||| ||||||  ||||||||||||||    
31543072 ggtttgaaccccggaccttgcatatattatgcattatccataccatctgagctaagctcacgaggaca 31543005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 121 - 184
Target Start/End: Complemental strand, 27244715 - 27244650
Alignment:
121 tttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| |||||||||||||||||||||  |||||| |||||||||  ||||||||||||||    
27244715 tttgaaccctagaccttgcatatattatgcattgtccctatcaactgagctaagctcacgaggaca 27244650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 30243321 - 30243259
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||||||||||||||| | |||||| |||||||||||||  || |||||||||||||    
30243321 gtggtggccgaggtttgaaccccgaaccttgtatatattatgcattgtctctaccaactgagc 30243259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 660813 - 660870
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaact 166  Q
    |||||| || ||||||||||||||||||||||||||||||||||  ||| ||||||||    
660813 tggtggtcggggtttgaaccctggaccttgcatatattatgcattgtccataccaact 660870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 7213453 - 7213371
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||||| | ||       |||||| |  |||||||||||||||||| |||||||||||||||||||||    
7213453 ttgtattgaaaagtgaaatgatttaattattttgggacacttattttttgcaaatgactcacttattatgggacggagggagt 7213371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 9472404 - 9472330
Alignment:
1 aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgg 75  Q
    |||||||||||||||||||||||| || ||        ||||||||||||||| |||||||||||||||||||||    
9472404 aatgttgtattgaaaagtgaaatgggttaatattctctggacaatatttttttacaaatgactcagttattatgg 9472330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 23250310 - 23250371
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||| || ||||||||||||||||||||||||||||||||||  | | |||||||||||    
23250310 gtggtggtcggggtttgaaccctggaccttgcatatattatgcattgttcttaccaactgag 23250371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 24356093 - 24356007
Alignment:
1 aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||||||| |||||       |||||||||||||||| ||||||  |||||||   |||||||||||||||    
24356093 aatgttgtattgaaaagtgaaatgggtcaagattcttgggacaatatttttttacaaatgggtcagttaaactgggacggagggagt 24356007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 109 - 183
Target Start/End: Complemental strand, 44526198 - 44526122
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    ||||||||| |||||||| || ||||||||| ||||||||||||  ||| ||||||||||||  |||||||||||||    
44526198 tggtggccggggtttgaatcccggaccttgcgtatattatgcattgtccataccaactgagctaagctcacgaggac 44526122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 119 - 184
Target Start/End: Original strand, 346125 - 346192
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||||||||||||||| |||||||||||||| || |  |||||||||||  ||||||||||||||    
346125 ggtttgaaccctggaccttacatatattatgcattattcaaaccaactgagctaagctcacgaggaca 346192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 3123580 - 3123540
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||| |||||||||||||||||||||||||||||    
3123580 tttttttgcaattgactcagttattatgggacggagggagt 3123540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 39 - 87
Target Start/End: Complemental strand, 6075440 - 6075392
Alignment:
39 ggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||||  |||||||||||||| |||||||||||    
6075440 ggacaatatttttttgcaaatagctcagttattatggaacggagggagt 6075392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 7649025 - 7649065
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||||||||||||| |||||||||||    
7649025 tttttttgcaaatgactcagttattatggaacggagggagt 7649065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 25604289 - 25604249
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||||||||||| |||||||||||||    
25604289 tttttttgcaaatgactcagttattataggacggagggagt 25604249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 27848229 - 27848185
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||| ||||||||||| ||||||||||||||||||||||    
27848229 gtggtggccggggtttgaaccccggaccttgcatatattatgcat 27848185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 28108553 - 28108593
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||| ||||||||||||||||||||||||||    
28108553 tttttttgcaaatggctcagttattatgggacggagggagt 28108593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 36359385 - 36359341
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||||| |||||||||||| ||||||||||||||||||||||    
36359385 gtggtggccaaggtttgaaccccggaccttgcatatattatgcat 36359341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 112 - 184
Target Start/End: Complemental strand, 7206192 - 7206118
Alignment:
112 tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||| ||||| ||||  ||||||||||||||||||||||  || |||||||||||||  ||||||||||||||    
7206192 tggccggggtttaaacctcggaccttgcatatattatgcattgtctctaccaactgagctaagctcacgaggaca 7206118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 147
Target Start/End: Original strand, 7645704 - 7645743
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatatta 147  Q
    ||||||||||||||||||||||||||| ||||||||||||    
7645704 gtggtggccgaggtttgaaccctggactttgcatatatta 7645743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 119 - 170
Target Start/End: Complemental strand, 11560558 - 11560507
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||||| ||||||||||||||||||||  |||||||||| |||||    
11560558 ggtttgaaccctgaaccttgcatatattatgcattgtccctaccaattgagc 11560507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 20455962 - 20455884
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| | || |||||| ||||||||||||||||||||||  ||| |||||| |||||  ||||||||||||||    
20455962 gtggtggccgggattcgaaccccggaccttgcatatattatgcattgtccataccaattgagctaagctcacgaggaca 20455884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 119 - 170
Target Start/End: Original strand, 25598563 - 25598614
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||| |||||||||||||||||||||||||||||  ||| ||||||||||||    
25598563 ggttcgaaccctggaccttgcatatattatgcattgtccataccaactgagc 25598614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 27411163 - 27411085
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| |||| |||||| |||||||||||||||||||||   ||| || |||||||||  ||||||||||||||    
27411163 gtggtggccggggttcgaaccccggaccttgcatatattatgcaaggtccatatcaactgagctaagctcacgaggaca 27411085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 48 - 87
Target Start/End: Complemental strand, 40964988 - 40964949
Alignment:
48 ttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||||||||||||||| ||||||||    
40964988 ttttttgcaaatgactcagttattatgggactgagggagt 40964949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 42066783 - 42066705
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||||||||  ||||| |||||||||||||||| |||||  ||| ||||||||||||  ||||||||| ||||    
42066783 gtggtggccgaggttcaaaccccggaccttgcatatattgtgcattgtccataccaactgagctaagctcacgatgaca 42066705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 112 - 183
Target Start/End: Original strand, 1861803 - 1861876
Alignment:
112 tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    ||||||| ||||||||| |||||||||||||||||||||||  ||| || || ||||||  |||||||||||||    
1861803 tggccgatgtttgaaccatggaccttgcatatattatgcattgtccatatcagctgagctaagctcacgaggac 1861876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 2257042 - 2256965
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggac 183  Q
    |||||||||| |||| ||||||  |||||||||||||||||||||  ||| |||||||||||   |||||||||||||    
2257042 gtggtggccggggttcgaaccccagaccttgcatatattatgcattgtccataccaactgagttaagctcacgaggac 2256965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 112 - 170
Target Start/End: Original strand, 4927443 - 4927501
Alignment:
112 tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||| ||||||||||| ||||||| |||||||||||| |  ||||||||||||||||    
4927443 tggccggggtttgaaccccggaccttacatatattatgctttgtccctaccaactgagc 4927501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 119 - 169
Target Start/End: Original strand, 5168580 - 5168630
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||||||| | |||||||||||||||||||| ||||||| ||||||||    
5168580 ggtttgaaccccgaaccttgcatatattatgcattatccctatcaactgag 5168630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 25186232 - 25186294
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||| | ||||||||||| ||||||||||||||||||||||  ||| || |||||||||    
25186232 gtggtggctggggtttgaaccccggaccttgcatatattatgcattgtccatatcaactgagc 25186294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 119 - 169
Target Start/End: Complemental strand, 27152413 - 27152363
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||| ||||||  ||||||||||||||||||||| ||||||||||||||||    
27152413 ggttcgaaccccagaccttgcatatattatgcattatccctaccaactgag 27152363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 112 - 170
Target Start/End: Complemental strand, 30978429 - 30978371
Alignment:
112 tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||| |||||||||||||  ||||||||||||||||||||| |||| |||||| |||||    
30978429 tggcagaggtttgaacccctgaccttgcatatattatgcattatccataccaattgagc 30978371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 31477042 - 31476980
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||| | ||||||||| | |||||| |||||||||||||  ||||||||||||||||    
31477042 gtggtggccgggatttgaaccccgaaccttgtatatattatgcattctccctaccaactgagc 31476980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 38 - 87
Target Start/End: Original strand, 6972706 - 6972755
Alignment:
38 gggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||| ||||||| ||| ||||||| ||||||||||||||    
6972706 gggacaatattttttagcaaatggctcggttattacgggacggagggagt 6972755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 117 - 170
Target Start/End: Complemental strand, 12124607 - 12124554
Alignment:
117 gaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||| |||||| ||||||||||||||||||||||  ||| ||||||||||||    
12124607 gaggttcgaaccccggaccttgcatatattatgcattgtccttaccaactgagc 12124554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 28572189 - 28572107
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||||| |||        |||||| | ||| |||||||||| |||||||||| |||||||||||||||    
28572189 ttgtattgaaaagtgaaatgactcagttattttgggacactttttatttgcaaatgtctcagttattgtgggacggagggagt 28572107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 50 - 87
Target Start/End: Original strand, 30757741 - 30757778
Alignment:
50 ttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||| ||||||||||||||||||||||||||    
30757741 ttttgcaaatggctcagttattatgggacggagggagt 30757778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 109 - 183
Target Start/End: Complemental strand, 34977274 - 34977198
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggac 183  Q
    ||||||||| ||||| ||| | ||||||||||||||||||||||  ||| |||||||||||   |||||||||||||    
34977274 tggtggccggggtttaaactccggaccttgcatatattatgcattgtccataccaactgagttaagctcacgaggac 34977198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 119 - 152
Target Start/End: Complemental strand, 37852070 - 37852037
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||||||||||||||||||||||||||||||    
37852070 ggtttgaaccctggaccttgcatatattatgcat 37852037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 38282550 - 38282632
Alignment:
1 aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagg 83  Q
    ||||||||||| |||||||| |||| ||||       ||||||||||||||||  |||||  |||||||||||||||||||||    
38282550 aatgttgtattaaaaagtgagatgaatcaagattcttgggacaatatttttttataaatggttcagttattatgggacggagg 38282632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 111 - 152
Target Start/End: Complemental strand, 42791363 - 42791322
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||| ||||||||||| ||||||||||||||||||||||    
42791363 gtggccggggtttgaaccccggaccttgcatatattatgcat 42791322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 3100335 - 3100295
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||| |||||||||| |||||||||||||||    
3100335 tttttttgcaaatggctcagttattgtgggacggagggagt 3100295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 4509608 - 4509564
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||| ||| |||||||| |||||||||||||||||||||||    
4509608 gtggtggctgagatttgaaccttggaccttgcatatattatgcat 4509564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 18460470 - 18460393
Alignment:
1 aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggac 78  Q
    ||||||||| ||||||| ||||| ||||||       |||||||||||||||  ||||||||||||||||| ||||||    
18460470 aatgttgtagtgaaaagagaaattagtcaagattcttgggacaatattttttaacaaatgactcagttattttgggac 18460393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 185
Target Start/End: Original strand, 20017046 - 20017125
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacag 185  Q
    |||||||||||| ||||||| | ||||||||||||||| |||||   ||| ||||| ||||||  |||||||||||||||    
20017046 gtggtggccgagatttgaactccggaccttgcatatataatgcaatgtccttaccagctgagctaagctcacgaggacag 20017125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 152
Target Start/End: Original strand, 24579670 - 24579702
Alignment:
120 gtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||||||||||||||||||||||||||    
24579670 gtttgaaccctggaccttgcatatattatgcat 24579702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 148
Target Start/End: Complemental strand, 31813049 - 31813009
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattat 148  Q
    ||||||||||| ||||||||| |||||||||||||||||||    
31813049 gtggtggccgatgtttgaaccttggaccttgcatatattat 31813009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 152
Target Start/End: Complemental strand, 32458361 - 32458329
Alignment:
120 gtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||||||||||||||||||||||||||    
32458361 gtttgaaccctggaccttgcatatattatgcat 32458329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #67
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 40710509 - 40710469
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||| |||||||||||||| |||||||||||||||||||||    
40710509 ttttgttgcaaatgactcatttattatgggacggagggagt 40710469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #68
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 109 - 169
Target Start/End: Complemental strand, 41859922 - 41859862
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||||| |||||||||||  |||||||||||| ||||||||  ||| |||||||||||    
41859922 tggtggccggggtttgaaccccagaccttgcatattttatgcattgtccataccaactgag 41859862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #69
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 119 - 170
Target Start/End: Original strand, 8781651 - 8781702
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||| |||||||||||| |||||||||  ||| ||||||||||||    
8781651 ggtttgaaccccggaccttgcatacattatgcattgtccataccaactgagc 8781702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #70
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 10724010 - 10723932
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggaca 184  Q
    |||||||||| ||||||||||   ||||||||||||||||||||| | ||  ||||||||||   ||||||||||||||    
10724010 gtggtggccggggtttgaacctcagaccttgcatatattatgcattacccaaaccaactgagttaagctcacgaggaca 10723932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #71
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 19976225 - 19976162
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcata-tattatgcatcatccctaccaactgagc 170  Q
    ||||||| ||||||| |||||| |||||||||||| ||||||||||  ||| ||||||||||||    
19976225 gtggtggtcgaggttcgaaccccggaccttgcatattattatgcattgtccataccaactgagc 19976162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #72
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 21482509 - 21482587
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||| || ||||  ||||| |||||||||||||||||| ||| |||| ||||||||||||  | ||||||||||||    
21482509 gtggtggtcggggttcaaaccccggaccttgcatatattatacattatccttaccaactgagctaaactcacgaggaca 21482587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #73
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 22523002 - 22523080
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| | ||||||||  | ||||||||||||||||| ||  ||| ||||||||||||  ||||||||||||||    
22523002 gtggtggccgggatttgaacctcgaaccttgcatatattatgtattgtccataccaactgagctaagctcacgaggaca 22523080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #74
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 119 - 170
Target Start/End: Complemental strand, 24593436 - 24593385
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||| |||||| ||||||||||||||||||||||  ||| ||||||||||||    
24593436 ggttcgaaccccggaccttgcatatattatgcattgtccttaccaactgagc 24593385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #75
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 120 - 180
Target Start/End: Complemental strand, 29599998 - 29599936
Alignment:
120 gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgag 180  Q
    |||||||||| |||||||| ||||||||||||| ||||  |||||||||||  ||||||||||    
29599998 gtttgaaccccggaccttggatatattatgcattatccaaaccaactgagctaagctcacgag 29599936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #76
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 33064057 - 33063979
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||||||  ||| |||| | ||||||||||||||||||||||  ||| || |||||||||  ||||||||||||||    
33064057 gtggtggccggagttcgaactccggaccttgcatatattatgcattgtccatatcaactgagctaagctcacgaggaca 33063979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #77
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 112 - 184
Target Start/End: Original strand, 41763872 - 41763946
Alignment:
112 tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||| ||||||||||| ||||| |||||||| |||||||  ||| ||||||||||||  || |||||||||||    
41763872 tggccggggtttgaaccccggaccgtgcatatactatgcattgtccataccaactgagctaagttcacgaggaca 41763946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #78
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 45032764 - 45032686
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggaca 184  Q
    |||||||| ||||||||| ||   || ||||||||||||||||||  |||||||||||||||   ||||||||||||||    
45032764 gtggtggctgaggtttgagcctcagatcttgcatatattatgcattgtccctaccaactgaggtaagctcacgaggaca 45032686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #79
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 112 - 170
Target Start/End: Original strand, 833063 - 833121
Alignment:
112 tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||| || |||||  |||||||||||||||||||||  ||| ||||||||||||    
833063 tggccgaggattaaaccccagaccttgcatatattatgcattgtccataccaactgagc 833121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #80
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 169
Target Start/End: Complemental strand, 961163 - 961113
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||| | |||||||||||||||||||||||  |||||||||| ||||    
961163 ggtttgaatcatggaccttgcatatattatgcattgtccctaccaattgag 961113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #81
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 133 - 184
Target Start/End: Original strand, 3197094 - 3197147
Alignment:
133 accttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||||||||||||||||  ||||||||||||||||  | ||||||||||||    
3197094 accttgcatatattatgcattgtccctaccaactgagctaaactcacgaggaca 3197147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #82
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 3708764 - 3708688
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||||| ||||||||| | ||||||||||||| ||||||||  | |||||||||| |||  |||||||||||||    
3708764 gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac 3708688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #83
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 111 - 169
Target Start/End: Original strand, 8091151 - 8091209
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||| ||| |||||||||| ||||||||||||||||||||||  ||| |||| ||||||    
8091151 gtggtcgatgtttgaaccccggaccttgcatatattatgcattgtccatacctactgag 8091209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #84
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 11868652 - 11868728
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||||| ||||||||| | ||||||||||||| ||||||||  | |||||||||| |||  |||||||||||||    
11868652 gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac 11868728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #85
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 13000756 - 13000694
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||| |||||||||| ||||  ||||||| |||||||||||||| |||  ||||||||||||    
13000756 gtggtagccgaggtttaaacctcggaccttacatatattatgcattatctttaccaactgagc 13000694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #86
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 20120711 - 20120773
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||| ||| | ||||||||| | ||||||||||||||||||||  ||| ||||||||||||    
20120711 gtggtgtccgggatttgaaccccgaaccttgcatatattatgcattgtccttaccaactgagc 20120773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #87
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 30045524 - 30045462
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||||||||||| |  | |||||| |||||||||||||  |||||||||| |||||    
30045524 gtggtggccgaggtttgaatctcgaaccttgtatatattatgcattgtccctaccaattgagc 30045462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #88
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 30050687 - 30050625
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||||||||||| |  | |||||| |||||||||||||  |||||||||| |||||    
30050687 gtggtggccgaggtttgaatctcgaaccttgtatatattatgcattgtccctaccaattgagc 30050625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #89
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 30141731 - 30141669
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||||||||||| |  | |||||| |||||||||||||  |||||||||| |||||    
30141731 gtggtggccgaggtttgaatctcgaaccttgtatatattatgcattgtccctaccaattgagc 30141669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #90
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 35360045 - 35360121
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||||| ||||||||| | ||||||||||||| ||||||||  | |||||||||| |||  |||||||||||||    
35360045 gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac 35360121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #91
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 124 - 170
Target Start/End: Original strand, 35685067 - 35685113
Alignment:
124 gaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||| |||||||||||||||||||||  ||| ||||||||||||    
35685067 gaaccctagaccttgcatatattatgcattgtccttaccaactgagc 35685113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #92
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 36474833 - 36474771
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||   ||||||||| ||||||||||||| ||||||||  |||||| |||||||||    
36474833 gtggtggccggaatttgaaccccggaccttgcatattttatgcattgtccctatcaactgagc 36474771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #93
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 42778688 - 42778629
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||||||||||||||| || ||||||||  ||||||||||||  ||| |||||||||||    
42778688 gtggtggccgaggtttgaatcccggaccttg--tatattatgcattgtccttaccaactgag 42778629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #94
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 109 - 170
Target Start/End: Complemental strand, 3617162 - 3617101
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||  ||||||||||||||| |||| ||||||||||||  ||| |||||| |||||    
3617162 tggtggccggagtttgaaccctggactttgcgtatattatgcattgtccttaccaattgagc 3617101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #95
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 119 - 164
Target Start/End: Complemental strand, 4180757 - 4180712
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaa 164  Q
    ||||||||||| ||||||||||||| |||||||| ||||| |||||    
4180757 ggtttgaaccccggaccttgcatattttatgcattatcccaaccaa 4180712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #96
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 4897614 - 4897553
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||  |||||||||| |  ||||||||||||||||||||  ||| |||||||||||    
4897614 gtggtggccagggtttgaaccataaaccttgcatatattatgcattgtccttaccaactgag 4897553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #97
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 4945008 - 4944947
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||  |||||||||| |  ||||||||||||||||||||  ||| |||||||||||    
4945008 gtggtggccagggtttgaaccataaaccttgcatatattatgcattgtccttaccaactgag 4944947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #98
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 124 - 169
Target Start/End: Complemental strand, 6141275 - 6141230
Alignment:
124 gaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||| |||||||||||||||||||||  ||| |||||||||||    
6141275 gaaccctagaccttgcatatattatgcattgtccttaccaactgag 6141230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #99
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 116 - 169
Target Start/End: Original strand, 6723075 - 6723128
Alignment:
116 cgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||| ||||||||||||||||||||||||| |||  ||| || ||||||||    
6723075 cgaggttcgaaccctggaccttgcatatattatacattgtccatatcaactgag 6723128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #100
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 121 - 170
Target Start/End: Complemental strand, 7350604 - 7350555
Alignment:
121 tttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||| ||| |||||||||||||||||  ||| ||||||||||||    
7350604 tttgaaccctagactttgcatatattatgcattgtccataccaactgagc 7350555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #101
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 153
Target Start/End: Complemental strand, 8728890 - 8728845
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatc 153  Q
    ||||||| || ||||||||||||||| ||||||||| |||||||||    
8728890 gtggtggtcggggtttgaaccctggatcttgcatattttatgcatc 8728845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #102
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 133 - 183
Target Start/End: Original strand, 9383224 - 9383276
Alignment:
133 accttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    ||||||||||||||||||||  ||| ||||||||||||  |||||||||||||    
9383224 accttgcatatattatgcattgtccataccaactgagctaagctcacgaggac 9383276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #103
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 133 - 183
Target Start/End: Original strand, 9842217 - 9842269
Alignment:
133 accttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    ||||||||||| ||||||||  ||||||||||||||||  |||||||||||||    
9842217 accttgcatattttatgcattgtccctaccaactgagctaagctcacgaggac 9842269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #104
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 117 - 170
Target Start/End: Complemental strand, 12124746 - 12124693
Alignment:
117 gaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||| |||| | ||||||||||||||||||||||  ||| ||||||||||||    
12124746 gaggttcgaactccggaccttgcatatattatgcattgtccttaccaactgagc 12124693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #105
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 129 - 170
Target Start/End: Complemental strand, 12231927 - 12231886
Alignment:
129 ctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||||||||||||||||| |||| ||||||| ||||    
12231927 ctggaccttgcatatattatgcattatccttaccaacagagc 12231886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #106
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 124 - 169
Target Start/End: Complemental strand, 14364109 - 14364064
Alignment:
124 gaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||||||| ||||||||||||||  ||| |||||||||||    
14364109 gaaccctggaccttacatatattatgcattgtccataccaactgag 14364064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #107
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 109 - 183
Target Start/End: Original strand, 14463737 - 14463812
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggac 183  Q
    ||||| ||| |||||||||| ||||| ||| |||||||||||||  |||||||||||||||   |||||||||||||    
14463737 tggtgtccggggtttgaacc-tggactttggatatattatgcattttccctaccaactgaggtaagctcacgaggac 14463812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #108
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 5 - 87
Target Start/End: Original strand, 18181343 - 18181425
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||| ||||         ||||||||||||| | ||||   ||||||||||||||||||||||||||    
18181343 ttgtattgaaaagtgaaatgggtcagttattttaggacaatatttttctacaaaaagctcagttattatgggacggagggagt 18181425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #109
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 119 - 152
Target Start/End: Original strand, 18693663 - 18693696
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||||||||||| ||||||||||||||||||    
18693663 ggtttgaaccctggatcttgcatatattatgcat 18693696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #110
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 111 - 152
Target Start/End: Complemental strand, 22709153 - 22709112
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||| ||||||||||| ||||||||||||| ||||||||    
22709153 gtggccggggtttgaaccccggaccttgcatattttatgcat 22709112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #111
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 25395432 - 25395493
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||| || | |||||||| || ||||||||||||||||||||  | |||||||||||||    
25395432 gtggtggtcgggatttgaaccttgaaccttgcatatattatgcattgttcctaccaactgag 25395493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #112
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 28844039 - 28843957
Alignment:
1 aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagg 83  Q
    |||||||||||||||| |||||||  ||||        ||||||||||||||| ||||||||||| |||||| |||| |||||    
28844039 aatgttgtattgaaaactgaaatggatcaaaattcttaggacaatatttttttacaaatgactcaattattacgggagggagg 28843957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #113
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 29809397 - 29809336
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||| | || |||||| | ||||| ||||||||||||||  |||||||||||||||    
29809397 gtggtggccgggattcgaaccccgtacctttcatatattatgcattgtccctaccaactgag 29809336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #114
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 149
Target Start/End: Original strand, 29872162 - 29872203
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatg 149  Q
    ||||||| ||||||||||||| | ||||||||||||||||||    
29872162 gtggtggtcgaggtttgaaccttagaccttgcatatattatg 29872203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #115
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 43 - 80
Target Start/End: Original strand, 29938101 - 29938138
Alignment:
43 aatatttttttgcaaatgactcagttattatgggacgg 80  Q
    ||||||||||||||||||||| ||||||||||| ||||    
29938101 aatatttttttgcaaatgactaagttattatggaacgg 29938138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #116
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 111 - 184
Target Start/End: Original strand, 32063580 - 32063656
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatatt-atgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||| |||||||||||||   |||||||||||| || |||||| |||| ||||||||||||  ||||||||||||||    
32063580 gtggtcgaggtttgaacctctgaccttgcatatttttatgcattatccataccaactgagctaagctcacgaggaca 32063656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #117
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 119 - 152
Target Start/End: Complemental strand, 38904121 - 38904088
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||||||||| ||||||||||||||||||||    
38904121 ggtttgaaccctgaaccttgcatatattatgcat 38904088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #118
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 149
Target Start/End: Complemental strand, 44810776 - 44810735
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatg 149  Q
    |||||||| | ||||||||||| |||||||||||||||||||    
44810776 gtggtggctggggtttgaaccccggaccttgcatatattatg 44810735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #119
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 170
Target Start/End: Complemental strand, 1844889 - 1844829
Alignment:
110 ggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||| |||||||| |||||| || || |||||||| ||||||  |||||||||||||||||    
1844889 ggtgtccgaggttcgaaccccggcccctgcatataatatgcaatatccctaccaactgagc 1844829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #120
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 7052845 - 7052766
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcata-tattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||| ||| ||||||| ||| |||||||||||| ||||||||||  ||| ||||||||||||  |||||||| |||||    
7052845 gtggtgtccggggtttgagccccggaccttgcatattattatgcattgtccttaccaactgagctaagctcacggggaca 7052766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #121
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 41 - 85
Target Start/End: Complemental strand, 12872942 - 12872898
Alignment:
41 acaatatttttttgcaaatgactcagttattatgggacggaggga 85  Q
    |||||||||| |||||||  ||||||||||| |||||||||||||    
12872942 acaatattttattgcaaaaaactcagttattttgggacggaggga 12872898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #122
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 15447704 - 15447748
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||| ||||||||| |  |||||||||||||||||||||    
15447704 gtggtggccggggtttgaactccagaccttgcatatattatgcat 15447748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #123
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 16390674 - 16390630
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||| |||| |||||| ||||||||||||| ||||||||    
16390674 gtggtggccggggttcgaaccccggaccttgcatattttatgcat 16390630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #124
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 20990894 - 20990938
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||| || ||||||||||||| ||||||||||| ||||||||    
20990894 gtggtggtcggggtttgaaccctgaaccttgcatattttatgcat 20990938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #125
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 21497738 - 21497694
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||||||||| ||||  | ||||||||||||||||||||    
21497738 gtggtggccgaggtttaaacctcgaaccttgcatatattatgcat 21497694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #126
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 22571855 - 22571899
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||| ||| ||||||||| |||| |||||||||||||||||    
22571855 gtggtggctgagatttgaaccccggacattgcatatattatgcat 22571899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #127
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 168
Target Start/End: Complemental strand, 26999181 - 26999121
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga 168  Q
    ||||||||||  |||||||||   |||||||||||||||||||||  || |||||||||||    
26999181 gtggtggccggagtttgaaccgcagaccttgcatatattatgcattgtctctaccaactga 26999121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #128
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 32204615 - 32204571
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||||||||||| ||| | |||| ||||||||||||||||||    
32204615 gtggtggccgaggttcgaatcttggatcttgcatatattatgcat 32204571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #129
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 164
Target Start/End: Original strand, 36264469 - 36264525
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaa 164  Q
    ||||||| || ||||||||||| | || ||||||||||||||||| |||| ||||||    
36264469 gtggtggtcggggtttgaaccccgaactttgcatatattatgcattatccataccaa 36264525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #130
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 182
Target Start/End: Original strand, 41939123 - 41939174
Alignment:
133 accttgcatatattatgcatcatccctaccaactgagc--agctcacgagga 182  Q
    ||||| |||||||||||||| ||||||||||||| |||  ||||||||||||    
41939123 accttacatatattatgcattatccctaccaactaagctaagctcacgagga 41939174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #131
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 77
Target Start/End: Original strand, 43427492 - 43427565
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaata-tttttttgcaaatgactcagttattatggga 77  Q
    ||||||||||||||||||||||||||       |||| |||| ||||||||||||| ||| | |||||||||||    
43427492 ttgtattgaaaagtgaaatgagtcaattttactgggataatattttttttgcaaataacttaattattatggga 43427565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #132
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 44534657 - 44534697
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||| |||||||||||||||| ||||||||| |||||    
44534657 tttttttgtaaatgactcagttattgtgggacggatggagt 44534697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 54; Significance: 4e-22; HSPs: 102)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 37496522 - 37496608
Alignment:
1 aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||| ||||||||||||||| |||||       |||| |||||||||||||||||||||||||||||||||||||||||||||    
37496522 aatgttgtgttgaaaagtgaaatgggtcaatttttttgggataatatttttttgcaaatgactcagttattatgggacggagggagt 37496608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 3 - 87
Target Start/End: Complemental strand, 34064195 - 34064111
Alignment:
3 tgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||| |||||| |||||||||||       |||||||||||||||||||||||||| |||||||||||||||||||||||    
34064195 tgttgtattaaaaagtaaaatgagtcaattttttcgggacaatatttttttgcaaatgactaagttattatgggacggagggagt 34064111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 32775960 - 32775878
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||| ||||||||||| |||||       ||||||||||||||||||||||| ||||||||||||||||||||||||||    
32775960 ttgtattggaaagtgaaatgggtcaatttttttgggacaatatttttttgcaaatgcctcagttattatgggacggagggagt 32775878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 21322246 - 21322185
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||| |||||||||||||||||||||||| ||||||||| |||| |||||||||||    
21322246 gtggtggccggggtttgaaccctggaccttgcatacattatgcattatccttaccaactgag 21322185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 19416585 - 19416507
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| ||||||||||| ||||||||||||| ||||||||  ||| ||||||||||||  ||||||||||||||    
19416585 gtggtggccggggtttgaaccccggaccttgcatattttatgcattgtccataccaactgagctaagctcacgaggaca 19416507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 27462426 - 27462504
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| ||||||||||| ||||||||||||||||||||||  ||| ||||||||||||   |||||||||||||    
27462426 gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagctatgctcacgaggaca 27462504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 3830139 - 3830077
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||| | ||||||||||||||||||||||||||||||||||  ||||||| ||||||||    
3830139 gtggtggctggggtttgaaccctggaccttgcatatattatgcattgtccctacaaactgagc 3830077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 10244797 - 10244721
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||||| ||||||||||| ||||||||||||||||||||||  ||| ||||||||||||  |||||||||||||    
10244797 gtggtggccg-ggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagctaagctcacgaggac 10244721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 16537526 - 16537588
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||| |||||||||||||||  ||||||| ||||||||||||| |||||||||||||||||    
16537526 gtggtgaccgaggtttgaaccccagaccttgtatatattatgcattatccctaccaactgagc 16537588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 16577850 - 16577912
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||||||||||||||  |||||||||||||||||| ||  ||||||||||||||||    
16577850 gtggtggccgaggtttgaaccccagaccttgcatatattatgtattgtccctaccaactgagc 16577912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 16587812 - 16587750
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||||||||||||||  |||||||||||||||||| ||  ||||||||||||||||    
16587812 gtggtggccgaggtttgaaccccagaccttgcatatattatgtattgtccctaccaactgagc 16587750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 16628136 - 16628074
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||| |||||||||||||||  ||||||| ||||||||||||| |||||||||||||||||    
16628136 gtggtgaccgaggtttgaaccccagaccttgtatatattatgcattatccctaccaactgagc 16628074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 5 - 87
Target Start/End: Original strand, 5068427 - 5068509
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||| ||||||||||||||||||       |||||||||| ||||| ||||||||||| ||||||||||||| |||||||    
5068427 ttgtattaaaaagtgaaatgagtcaatattcttgggacaatatatttttacaaatgactcacttattatgggacgaagggagt 5068509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 39 - 87
Target Start/End: Complemental strand, 32346457 - 32346409
Alignment:
39 ggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||| ||||||||||||| |||||||||||||||||||||    
32346457 ggacaatatttttatgcaaatgactcacttattatgggacggagggagt 32346409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 3 - 87
Target Start/End: Original strand, 3668004 - 3668088
Alignment:
3 tgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||||| |||||        ||||||||||||||| |||||||||||||||||| || ||||| |||||    
3668004 tgttgtattgaaaagtgaaatgggtcaatttttttaggacaatatttttttacaaatgactcagttattacggaacggatggagt 3668088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 166
Target Start/End: Original strand, 21554924 - 21554982
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaact 166  Q
    ||||||| || |||||||| |||||||||||||||||||| |||| |||||||||||||    
21554924 gtggtggtcggggtttgaatcctggaccttgcatatattaagcattatccctaccaact 21554982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 47607900 - 47607962
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||  |||||||||||||||||||||||||||||| |   ||||||||||||||||    
47607900 gtggtggccggagtttgaaccctggaccttgcatatattatgtaatgtccctaccaactgagc 47607962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 2846801 - 2846887
Alignment:
1 aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||| |||||||||||||||||||| |||        |||||| | |||| ||| ||||||||||||||||||||||||||||||||    
2846801 aatgatgtattgaaaagtgaaatgactcacttattttgggacacttttttattgaaaatgactcagttattatgggacggagggagt 2846887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 38 - 87
Target Start/End: Complemental strand, 18731387 - 18731338
Alignment:
38 gggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||| |||| ||||||||||| ||||||||||||||||    
18731387 gggacaatatttttttacaaacgactcagttatcatgggacggagggagt 18731338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 38 - 83
Target Start/End: Complemental strand, 47238163 - 47238118
Alignment:
38 gggacaatatttttttgcaaatgactcagttattatgggacggagg 83  Q
    ||||||||||||||||||||||| |||| |||||||||||||||||    
47238163 gggacaatatttttttgcaaatggctcaattattatgggacggagg 47238118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 30462952 - 30462912
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||| |||||||||||||||||||||    
30462952 tttttttgcaaatgactcaattattatgggacggagggagt 30462912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 31581620 - 31581660
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||||||||||||||||||| ||||    
31581620 tttttttgcaaatgactcagttattatgggacggagagagt 31581660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 5579764 - 5579686
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||| || |||||||||||  ||||||||||||||||||||   ||||||||||||||||  ||||||| ||||||    
5579764 gtggtggtcggggtttgaaccccagaccttgcatatattatgcactgtccctaccaactgagctaagctcacaaggaca 5579686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 109 - 152
Target Start/End: Complemental strand, 10327023 - 10326981
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||||||||||||| |||||||||||||||||||||||    
10327023 tggtggccgaggtttgaacc-tggaccttgcatatattatgcat 10326981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 119 - 170
Target Start/End: Complemental strand, 18714508 - 18714457
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||| ||||||||||||||||||||||  ||| ||||||||||||    
18714508 ggtttgaaccccggaccttgcatatattatgcattgtccttaccaactgagc 18714457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 110 - 169
Target Start/End: Complemental strand, 19599214 - 19599155
Alignment:
110 ggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||| || ||||||||||| ||||||||||||||||||||||  ||| |||||||||||    
19599214 ggtggtcggggtttgaaccccggaccttgcatatattatgcattgtccataccaactgag 19599155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 115 - 170
Target Start/End: Original strand, 29237554 - 29237609
Alignment:
115 ccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||| |||||||||||||||||||||||||||||  | | ||||||||||||    
29237554 ccgaggttcgaaccctggaccttgcatatattatgcattgttcttaccaactgagc 29237609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 31038512 - 31038590
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| |||||||||||  ||||||||||| | |||||||  ||| ||||||||||||  ||||||||||||||    
31038512 gtggtggccggggtttgaaccccagaccttgcatacaatatgcattgtccataccaactgagctaagctcacgaggaca 31038590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 109 - 152
Target Start/End: Original strand, 42095934 - 42095977
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||| ||||||||||||| ||||||||||||||||||||||    
42095934 tggtggcagaggtttgaaccccggaccttgcatatattatgcat 42095977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 42829224 - 42829302
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggaca 184  Q
    ||||||||||  |||||||||| ||| ||||||||||||||||||  |||||| ||||||||   ||||||||||||||    
42829224 gtggtggccggagtttgaaccccggagcttgcatatattatgcattgtccctatcaactgagtcaagctcacgaggaca 42829302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 14046601 - 14046678
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggac 183  Q
    |||||||||| ||||||||||| | | |||||||||||||||||| | || |||||||||||   |||||||||||||    
14046601 gtggtggccggggtttgaaccccgtatcttgcatatattatgcattacccataccaactgagataagctcacgaggac 14046678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 14356631 - 14356708
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggac 183  Q
    |||||||||| ||||||||||| | | |||||||||||||||||| | || |||||||||||   |||||||||||||    
14356631 gtggtggccggggtttgaaccccgtatcttgcatatattatgcattacccataccaactgagataagctcacgaggac 14356708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 5 - 83
Target Start/End: Complemental strand, 25778715 - 25778636
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatattttttt-gcaaatgactcagttattatgggacggagg 83  Q
    ||||||||||||||||||| ||||||       | |||||||||||||| | ||||||| ||||||||||||||||||||    
25778715 ttgtattgaaaagtgaaataagtcaatttttttgagacaatattttttttgaaaatgacccagttattatgggacggagg 25778636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 27833391 - 27833453
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||| || ||||||||||| ||||||| ||||||||||||||  ||| ||||||||||||    
27833391 gtggtggtcggggtttgaaccccggaccttacatatattatgcattgtccttaccaactgagc 27833453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 46987157 - 46987095
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||| ||| |||| |||||| ||||||||||||||||||||||  ||| ||||||||||||    
46987157 gtggtgtccggggttcgaaccccggaccttgcatatattatgcattgtccttaccaactgagc 46987095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 111 - 152
Target Start/End: Complemental strand, 7670502 - 7670461
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||| |||||||||||||| ||||||||||||||||||||||    
7670502 gtggtcgaggtttgaaccccggaccttgcatatattatgcat 7670461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 119 - 152
Target Start/End: Complemental strand, 10242540 - 10242507
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||||||||||||||||||||||||||||||    
10242540 ggtttgaaccctggaccttgcatatattatgcat 10242507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 120 - 161
Target Start/End: Complemental strand, 18023738 - 18023697
Alignment:
120 gtttgaaccctggaccttgcatatattatgcatcatccctac 161  Q
    |||||||||||||||||||||||||||||||||  |||||||    
18023738 gtttgaaccctggaccttgcatatattatgcattgtccctac 18023697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 113 - 170
Target Start/End: Original strand, 38374186 - 38374243
Alignment:
113 ggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||| |||||||||||||||||||||||||| |||||||  ||| |||||| |||||    
38374186 ggccggggtttgaaccctggaccttgcatatactatgcattgtccataccaattgagc 38374243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 108 - 161
Target Start/End: Original strand, 47155094 - 47155147
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctac 161  Q
    |||||| ||| |||| |||||||||||||||||||||||||||||  |||||||    
47155094 gtggtgtccggggttcgaaccctggaccttgcatatattatgcattgtccctac 47155147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 7426048 - 7426088
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||| |||||||||| |||||||||||||||    
7426048 tttttttgcaaatggctcagttattgtgggacggagggagt 7426088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 11616491 - 11616451
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||| |||||||||||||||| |||||||||    
11616491 tttttttgcaaatggctcagttattatgggatggagggagt 11616451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 168
Target Start/End: Complemental strand, 12212344 - 12212285
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga 168  Q
    |||||| |||||||| |||||||| |||||||||||||||| |||| ||| ||||||||||    
12212344 gtggtgtccgaggttcgaaccctg-accttgcatatattatacatcgtccttaccaactga 12212285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 111 - 184
Target Start/End: Original strand, 19626518 - 19626593
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggaca 184  Q
    |||||||  |||||||||| ||||||||||||||||||||||  |||  ||||||||||   ||||||||||||||    
19626518 gtggccggtgtttgaaccccggaccttgcatatattatgcattgtccaaaccaactgagttaagctcacgaggaca 19626593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 39 - 87
Target Start/End: Original strand, 23111693 - 23111741
Alignment:
39 ggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||||||||| | ||||||||| || ||||||||    
23111693 ggacaatatttttttgcaaatgacttatttattatggaacagagggagt 23111741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 152
Target Start/End: Original strand, 26717930 - 26717962
Alignment:
120 gtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||||||||||||||||||||||||||    
26717930 gtttgaaccctggaccttgcatatattatgcat 26717962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 33473511 - 33473555
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||  |||| |||||||||||||||||||||||||||||    
33473511 gtggtggccagggttggaaccctggaccttgcatatattatgcat 33473555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 119 - 184
Target Start/End: Original strand, 34448611 - 34448678
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggaca 184  Q
    ||||||||||||||||||| ||||||||||||||  |||  ||||||||||   ||||||||||||||    
34448611 ggtttgaaccctggaccttacatatattatgcattgtccaaaccaactgagttaagctcacgaggaca 34448678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 133 - 169
Target Start/End: Original strand, 44941428 - 44941464
Alignment:
133 accttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||||||||||||| ||||||||||||||||    
44941428 accttgcatatattatgcattatccctaccaactgag 44941464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 111 - 184
Target Start/End: Complemental strand, 46737853 - 46737778
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||  |||||||||| ||||||||||||||||||||||  |||  || ||||||||  ||||||||||||||    
46737853 gtggccggtgtttgaaccccggaccttgcatatattatgcattgtccaaacaaactgagctaagctcacgaggaca 46737778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 124 - 184
Target Start/End: Complemental strand, 2618734 - 2618672
Alignment:
124 gaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||| ||||||||||||||||||||||  ||| ||||||||||||  |||||||| |||||    
2618734 gaaccccggaccttgcatatattatgcattgtccttaccaactgagcgaagctcacggggaca 2618672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 119 - 183
Target Start/End: Complemental strand, 4047845 - 4047780
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    ||||| ||||||| |||||||||||||||||||| || |||| |||||||||  |||||||||||||    
4047845 ggtttaaaccctgaaccttgcatatattatgcattat-cctatcaactgagctaagctcacgaggac 4047780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 136 - 184
Target Start/End: Complemental strand, 5833085 - 5833035
Alignment:
136 ttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||||||||||||| |||||||||||||||||  |||||||| |||||    
5833085 ttgcatatattatgcattatccctaccaactgagctaagctcacggggaca 5833035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 180
Target Start/End: Complemental strand, 21174430 - 21174356
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgag 180  Q
    |||||||||| ||||||||||| ||| ||| |||||| ||| |||  ||||||||||||||||  ||||||||||    
21174430 gtggtggccggggtttgaaccccggaactttcatatagtattcattgtccctaccaactgagctaagctcacgag 21174356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 119 - 166
Target Start/End: Original strand, 24824413 - 24824460
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaact 166  Q
    |||||||||| |||||||||||||| |||||||| |||| ||||||||    
24824413 ggtttgaaccatggaccttgcatattttatgcattatccataccaact 24824460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 131 - 170
Target Start/End: Complemental strand, 25888948 - 25888909
Alignment:
131 ggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||||||||||||||| ||| ||||||||||||    
25888948 ggaccttgcatatattatgcatcgtccttaccaactgagc 25888909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 136 - 184
Target Start/End: Original strand, 26816682 - 26816732
Alignment:
136 ttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||||||||||||| |||||||||||||||||  |||||||| |||||    
26816682 ttgcatatattatgcattatccctaccaactgagctaagctcacggggaca 26816732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 116 - 184
Target Start/End: Original strand, 27993027 - 27993097
Alignment:
116 cgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggaca 184  Q
    ||||||||||||||| |||||||||||| ||||||||  | | |||||||||||   ||||||||||||||    
27993027 cgaggtttgaaccctagaccttgcatattttatgcattgttcataccaactgagttaagctcacgaggaca 27993097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 37624614 - 37624536
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggaca 184  Q
    |||||||||| | || ||||||  |||||||||||||||||||||  ||| |||||||||||   ||||||||||||||    
37624614 gtggtggccgggattcgaacccccgaccttgcatatattatgcattgtccataccaactgaggaaagctcacgaggaca 37624536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #60
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 38088007 - 38088085
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||| |||||||||||||| | || ||||||||||||||||  |  ||| ||||||||||||  ||||||||||||||    
38088007 gtggttgccgaggtttgaactcaggtccttgcatatattatgttttgtccttaccaactgagctaagctcacgaggaca 38088085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #61
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 40 - 87
Target Start/End: Complemental strand, 39498617 - 39498570
Alignment:
40 gacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||| |||| | |||||||||||||| |||||||||||    
39498617 gacaatatttttttacaaaaggctcagttattatggaacggagggagt 39498570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #62
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 109 - 168
Target Start/End: Original strand, 48629056 - 48629115
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga 168  Q
    |||||| || ||||| ||||| ||||||||||||||||||||||  |||||| |||||||    
48629056 tggtggtcggggtttaaaccccggaccttgcatatattatgcattgtccctaacaactga 48629115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #63
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 87
Target Start/End: Original strand, 5724882 - 5724920
Alignment:
49 tttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||| |||||||||||||||||||| |||||||||||    
5724882 tttttgtaaatgactcagttattatggaacggagggagt 5724920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #64
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 47 - 81
Target Start/End: Original strand, 6838602 - 6838636
Alignment:
47 tttttttgcaaatgactcagttattatgggacgga 81  Q
    ||||||||||||||||||| |||||||||||||||    
6838602 tttttttgcaaatgactcacttattatgggacgga 6838636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #65
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 20763225 - 20763149
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||||| ||||||||| | ||||||||||||| ||||||||  | |||||||||| |||  |||||||||||||    
20763225 gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac 20763149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #66
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 112 - 170
Target Start/End: Complemental strand, 24657037 - 24656979
Alignment:
112 tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||| |||||| |||| ||||||||| ||||| |||||||| |||| ||||||||||||    
24657037 tggctgaggttcgaactctggaccttacatattttatgcattatccataccaactgagc 24656979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #67
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 29488791 - 29488715
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||||| ||||||||| | ||||||||||||| ||||||||  | |||||||||| |||  |||||||||||||    
29488791 gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac 29488715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #68
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 33232387 - 33232463
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||||| ||||||||| | ||||||||||||| ||||||||  | |||||||||| |||  |||||||||||||    
33232387 gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac 33232463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #69
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 34284529 - 34284605
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||||| ||||||||| | ||||||||||||| ||||||||  | |||||||||| |||  |||||||||||||    
34284529 gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac 34284605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #70
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 120 - 170
Target Start/End: Original strand, 39280820 - 39280870
Alignment:
120 gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||| ||||||||||||||||||||||  | | ||||||||||||    
39280820 gtttgaaccccggaccttgcatatattatgcattgttcttaccaactgagc 39280870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #71
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 135 - 169
Target Start/End: Original strand, 39458561 - 39458595
Alignment:
135 cttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||||||||||| ||||||||||||||||    
39458561 cttgcatatattatgcattatccctaccaactgag 39458595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #72
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 109 - 184
Target Start/End: Original strand, 40752830 - 40752907
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||||| |||| |||||| |||| |||||||||||||| ||  ||| ||| ||||||||  ||||||||||||||    
40752830 tggtggccggggttcgaaccccggacattgcatatattatgtattgtccatactaactgagctaagctcacgaggaca 40752907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #73
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 120 - 170
Target Start/End: Original strand, 42753529 - 42753579
Alignment:
120 gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||| |||||||||||||||||||||   ||||| ||||||||||    
42753529 gtttgaaccccggaccttgcatatattatgcactgtcccttccaactgagc 42753579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #74
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 112 - 170
Target Start/End: Original strand, 43579047 - 43579105
Alignment:
112 tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||| |||| |||||| |||| |||||| ||||||||||  ||||||||||||||||    
43579047 tggccggggttcgaacccaggactttgcatgtattatgcattgtccctaccaactgagc 43579105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #75
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 111 - 152
Target Start/End: Original strand, 1079685 - 1079726
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||||| ||||||||| ||||||||||||| ||||||||    
1079685 gtggccgagatttgaaccccggaccttgcatattttatgcat 1079726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #76
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 182
Target Start/End: Complemental strand, 3953510 - 3953436
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgagga 182  Q
    ||||||||| |||||||||||| | ||||||||||||||||||||  ||| |||| |||||||  ||||||||||||    
3953510 gtggtggcc-aggtttgaaccc-gaaccttgcatatattatgcattgtccataccgactgagctaagctcacgagga 3953436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #77
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 145
Target Start/End: Complemental strand, 5804832 - 5804795
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatat 145  Q
    |||||||||| |||| ||||||||||||||||||||||    
5804832 gtggtggccggggttcgaaccctggaccttgcatatat 5804795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #78
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 119 - 152
Target Start/End: Complemental strand, 6781867 - 6781834
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||||||||||||||||||||| ||||||||    
6781867 ggtttgaaccctggaccttgcatattttatgcat 6781834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #79
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 109 - 170
Target Start/End: Complemental strand, 18684199 - 18684139
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||| || ||||||||||| |||||||||||| ||||||||| |||| || |||||||||    
18684199 tggtggtcggggtttgaaccc-ggaccttgcatacattatgcattatccatatcaactgagc 18684139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #80
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 111 - 152
Target Start/End: Original strand, 19988688 - 19988729
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||||||||| ||||  ||||||||||||||||||||||    
19988688 gtggccgaggtttaaaccacggaccttgcatatattatgcat 19988729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #81
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 119 - 152
Target Start/End: Original strand, 20085760 - 20085793
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||||||| ||||||||||||||||||||||    
20085760 ggtttgaaccccggaccttgcatatattatgcat 20085793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #82
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 185
Target Start/End: Complemental strand, 20243327 - 20243247
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatat-attatgcatcatccctaccaactgagc--agctcacgaggacag 185  Q
    |||||| ||| ||||  ||||| ||||||||||||| |||||||||  ||| ||||||||||||  |||||||||||||||    
20243327 gtggtgtccggggttcaaaccccggaccttgcatattattatgcattgtccataccaactgagctaagctcacgaggacag 20243247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #83
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 38 - 87
Target Start/End: Original strand, 26938601 - 26938650
Alignment:
38 gggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||| | ||| |||||||||||||||| |||| |||||||||||||||    
26938601 gggacactttttatttgcaaatgactcagctattgtgggacggagggagt 26938650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #84
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 5 - 87
Target Start/End: Original strand, 33774170 - 33774252
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||||| |||        || ||| | |||||||| |||||||||||||||| || ||||||||||||    
33774170 ttgtattgaaaagtgaaatgactcagttattttggaacactttttttttgtaaatgactcagttattgtgagacggagggagt 33774252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #85
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 112 - 165
Target Start/End: Original strand, 36033458 - 36033511
Alignment:
112 tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaac 165  Q
    |||||||| ||||||||| | |||||||||||||||| ||| || |||||||||    
36033458 tggccgagatttgaaccccgaaccttgcatatattatacattattcctaccaac 36033511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #86
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 111 - 152
Target Start/End: Complemental strand, 36121720 - 36121679
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||| ||||||||||| ||||||||||||| ||||||||    
36121720 gtggccggggtttgaaccccggaccttgcatattttatgcat 36121679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #87
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 149
Target Start/End: Original strand, 42219377 - 42219418
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatg 149  Q
    ||||||||||| |||||||||  |||||||||||||||||||    
42219377 gtggtggccgatgtttgaacctcggaccttgcatatattatg 42219418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #88
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 124 - 152
Target Start/End: Complemental strand, 2648327 - 2648299
Alignment:
124 gaaccctggaccttgcatatattatgcat 152  Q
    |||||||||||||||||||||||||||||    
2648327 gaaccctggaccttgcatatattatgcat 2648299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #89
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 8084498 - 8084454
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||| |||| |||||| ||||||||||||| ||||||||    
8084498 gtggtggccggggttcgaaccccggaccttgcatattttatgcat 8084454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #90
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 9658774 - 9658734
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||||| |||| ||||||| |||||    
9658774 tttttttgcaaatgactcagttgttataggacggatggagt 9658734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #91
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 12308316 - 12308276
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||| |||||||||| |||||| |||||||||||||||    
12308316 ttttttttcaaatgactcggttattgtgggacggagggagt 12308276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #92
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 16198454 - 16198410
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||||| || |||| | ||||||||||||||||||||||    
16198454 gtggtggccgagattcgaactccggaccttgcatatattatgcat 16198410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #93
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 180
Target Start/End: Original strand, 18505659 - 18505721
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgag 180  Q
    ||||||||||| ||| ||||||||| ||||||||  ||||||||||||||||  ||||||||||    
18505659 ggtttgaaccc-ggatcttgcatattttatgcattgtccctaccaactgagctaagctcacgag 18505721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #94
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 132 - 168
Target Start/End: Complemental strand, 25923438 - 25923402
Alignment:
132 gaccttgcatatattatgcatcatccctaccaactga 168  Q
    ||||||||||||||||||||| |||||||| ||||||    
25923438 gaccttgcatatattatgcattatccctactaactga 25923402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #95
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 109 - 169
Target Start/End: Complemental strand, 27270305 - 27270245
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||| |||||| |||| | | ||||||||||||||||||||  ||| |||||||||||    
27270305 tggtggctgaggttcgaactccgaaccttgcatatattatgcattgtccataccaactgag 27270245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #96
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 109 - 149
Target Start/End: Complemental strand, 29986667 - 29986627
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatg 149  Q
    |||||| || ||||||||||||||||||||| |||||||||    
29986667 tggtggacggggtttgaaccctggaccttgcgtatattatg 29986627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #97
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 33584498 - 33584458
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||| ||| ||||| ||||||||||||||||||||||||||    
33584498 ttttattgaaaatgcctcagttattatgggacggagggagt 33584458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #98
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 34963986 - 34964026
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||| |||||||||||||||||||| |||||| |||||    
34963986 tttttttacaaatgactcagttattatgagacggatggagt 34964026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #99
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 121 - 169
Target Start/End: Original strand, 37230031 - 37230079
Alignment:
121 tttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||  |||||||||||||||||||||  ||| |||||||||||    
37230031 tttgaaccccagaccttgcatatattatgcattttccttaccaactgag 37230079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #100
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 126 - 183
Target Start/End: Complemental strand, 39801759 - 39801700
Alignment:
126 accctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||| ||| ||||||||||||||||||  ||| ||||||||||||  |||||||||||||    
39801759 accccggatcttgcatatattatgcattgtccataccaactgagctaagctcacgaggac 39801700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #101
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 184
Target Start/End: Original strand, 43539105 - 43539172
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||||||| ||||||| ||||||||||||||  | |||| |||||||||  ||||||| ||||||    
43539105 ggtttgaaccccggaccttacatatattatgcattgttcctatcaactgagctaagctcacaaggaca 43539172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #102
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 46095617 - 46095657
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||| |||| |||||||||||||||||| ||||    
46095617 tttttttgcaaacgacttagttattatgggacggagagagt 46095657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 122)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 38 - 87
Target Start/End: Complemental strand, 2886116 - 2886067
Alignment:
38 gggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
2886116 gggacaatatttttttgcaaatgactcagttattatgggacggagggagt 2886067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 111 - 184
Target Start/End: Original strand, 41763148 - 41763223
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||| ||||||||||| ||||||||||||| |||||||| |||||||||||||||||  ||||||||||||||    
41763148 gtggccggggtttgaaccccggaccttgcatattttatgcattatccctaccaactgagctaagctcacgaggaca 41763223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 15854078 - 15854140
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||||||||||| |||||| ||||||||||||||||||| ||| ||||||||||||    
15854078 gtggtggccgaggtttgaatcctggatcttgcatatattatgcatcgtccataccaactgagc 15854140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 34521180 - 34521242
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||||||||||||||| ||||||||||||||||||||||  ||| ||||||||||||    
34521180 gtggtggccgaggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagc 34521242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 108 - 166
Target Start/End: Original strand, 46149034 - 46149092
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaact 166  Q
    |||||||||| |||||||||| ||||||||||||||| |||||||||||||||||||||    
46149034 gtggtggccggggtttgaaccttggaccttgcatataatatgcatcatccctaccaact 46149092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 5 - 82
Target Start/End: Complemental strand, 29225731 - 29225654
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggag 82  Q
    |||||||||||||||||||| |||||       |||||||||||||||| |||||||||||||||||||||| |||||    
29225731 ttgtattgaaaagtgaaatgggtcaatctttttgggacaatatttttttacaaatgactcagttattatggggcggag 29225654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 5 - 85
Target Start/End: Complemental strand, 26583706 - 26583626
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggaggga 85  Q
    |||||||||||||||||||| |||||       | ||||||||||||||||||||  ||||||||||||||||||||||||    
26583706 ttgtattgaaaagtgaaatgggtcaatttttttgagacaatatttttttgcaaatagctcagttattatgggacggaggga 26583626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 40 - 87
Target Start/End: Complemental strand, 50333878 - 50333831
Alignment:
40 gacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||    
50333878 gacaatatttttttgcaaatgactcagttattatgggtcggagggagt 50333831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 17139507 - 17139584
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    ||||||| || ||||||||||| |||||||| |||||||||||||  ||||||||||||||||  |||||||||||||    
17139507 gtggtggtcggggtttgaaccccggaccttgaatatattatgcattgtccctaccaactgagctaagctcacgaggac 17139584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 5 - 87
Target Start/End: Original strand, 26924399 - 26924480
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||||| ||||       |||||||||||||||  ||||||||||| |||||||||||||||||||||    
26924399 ttgtattgaaaagtgaaatgaatcaatttttctgggacaatatttttta-caaatgactcaattattatgggacggagggagt 26924480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 108 - 157
Target Start/End: Complemental strand, 34595943 - 34595894
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatcc 157  Q
    |||||||||||||||||||||| |||||||||||||||||||||| ||||    
34595943 gtggtggccgaggtttgaaccccggaccttgcatatattatgcattatcc 34595894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 5 - 79
Target Start/End: Original strand, 37541247 - 37541321
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacg 79  Q
    ||||||||||||||||||| | ||||       | ||||||||||||||||||||||||||||||||||||||||    
37541247 ttgtattgaaaagtgaaataaatcaatctttctgagacaatatttttttgcaaatgactcagttattatgggacg 37541321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 3481632 - 3481553
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgca-tcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| |||||||||||  |||||||||||||||||||| |  ||||||||||||||||  ||||||||||||||    
3481632 gtggtggccggggtttgaaccccagaccttgcatatattatgcatttgtccctaccaactgagctaagctcacgaggaca 3481553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 39 - 87
Target Start/End: Original strand, 29225571 - 29225619
Alignment:
39 ggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||| |||||| ||||||||||||||||||||||||||    
29225571 ggacaatatttttttacaaatggctcagttattatgggacggagggagt 29225619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 119 - 184
Target Start/End: Original strand, 37045147 - 37045214
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||| |||||||||||||||||||||||||||||  | ||||||||||||||  ||||||||||||||    
37045147 ggttcgaaccctggaccttgcatatattatgcattgttcctaccaactgagctgagctcacgaggaca 37045214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 1794667 - 1794589
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||| |||||||||||||| ||| ||||||||||||||||||  ||| ||| ||||||||  ||||||||||||||    
1794667 gtggtggtcgaggtttgaaccccggatcttgcatatattatgcattgtccatactaactgagctaagctcacgaggaca 1794589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 5 - 81
Target Start/End: Complemental strand, 5503395 - 5503319
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacgga 81  Q
    ||||||||||||||||||| ||||||       | |||||||||||||| |||||||||||||||||||| ||||||    
5503395 ttgtattgaaaagtgaaattagtcaatttttttgagacaatatttttttacaaatgactcagttattatgagacgga 5503319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 5907870 - 5907792
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||| ||| ||||||||||||||||||||||||||||||||||  ||| | ||||||||||  |||||||| |||||    
5907870 gtggtgtccggggtttgaaccctggaccttgcatatattatgcattgtccttgccaactgagctaagctcacggggaca 5907792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 7925434 - 7925357
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||||||||||||||| | ||||| ||||||||||||||  || |||||||||||||  ||||||||||||||    
7925434 gtggtggccgaggtttgaaccccgaacctt-catatattatgcattgtctctaccaactgagctaagctcacgaggaca 7925357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 30678803 - 30678881
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggaca 184  Q
    ||||||||||| ||||||||| || ||||| ||||||||||||||  |||||||||||||||   ||||||||||||||    
30678803 gtggtggccgaagtttgaaccatgaaccttacatatattatgcattgtccctaccaactgagttaagctcacgaggaca 30678881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 42045362 - 42045440
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| ||||||||| |  |||||||||||||||||||||  ||| ||||||||||||  ||||||||||||||    
42045362 gtggtggccggggtttgaactccagaccttgcatatattatgcattgtccataccaactgagctaagctcacgaggaca 42045440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 45139996 - 45140074
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| ||||| ||| ||||||||||||||||||||||||  ||| ||||||||||||  |||||||| |||||    
45139996 gtggtggccggggtttaaactctggaccttgcatatattatgcattgtccataccaactgagctaagctcacggggaca 45140074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 39 - 85
Target Start/End: Original strand, 7310706 - 7310752
Alignment:
39 ggacaatatttttttgcaaatgactcagttattatgggacggaggga 85  Q
    |||||||||||||||| |||||||||||||||||||| |||||||||    
7310706 ggacaatatttttttgtaaatgactcagttattatggaacggaggga 7310752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 112 - 183
Target Start/End: Complemental strand, 26755683 - 26755610
Alignment:
112 tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||||||||||||| ||||||||||||||| ||||||  ||| || |||||||||  |||||||||||||    
26755683 tggccgaggtttgaaccccggaccttgcatatataatgcattgtccatatcaactgagctaagctcacgaggac 26755610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 27533314 - 27533237
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    ||||||| || ||||||||||| | ||||||||||||||||||||  |||||||||||||| |  |||||||||||||    
27533314 gtggtggtcggggtttgaaccccgaaccttgcatatattatgcattgtccctaccaactgatctaagctcacgaggac 27533237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 29739408 - 29739346
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||| |||||||||||||||| ||||||||||||| ||||||||  ||| ||||||||||||    
29739408 gtggtagccgaggtttgaaccccggaccttgcatattttatgcattgtccttaccaactgagc 29739346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 5 - 87
Target Start/End: Original strand, 29756274 - 29756357
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttt-tttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||| |||||        |||||||||||| |||||||||| ||| ||||||||||||||||||||||    
29756274 ttgtattgaaaagtgaaatgggtcaatttttctaggacaatattttttttgcaaatggctctgttattatgggacggagggagt 29756357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 49431983 - 49432045
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||| ||||||||||| ||||||| |||||||||||||| || ||||||||| ||||    
49431983 gtggtggccggggtttgaaccccggaccttacatatattatgcattattcctaccaaccgagc 49432045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 50638906 - 50638968
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||| | || |||||||||||||||||||||||||||||  ||| ||||||||||||    
50638906 gtggtggccgggattcgaaccctggaccttgcatatattatgcattgtccttaccaactgagc 50638968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 114 - 183
Target Start/End: Complemental strand, 25533038 - 25532967
Alignment:
114 gccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||| ||||||||||| ||||||||||||||||||||||  ||| |||||||||| |  |||||||||||||    
25533038 gccggggtttgaaccccggaccttgcatatattatgcattgtccataccaactgaactaagctcacgaggac 25532967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 108 - 164
Target Start/End: Complemental strand, 41973326 - 41973270
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaa 164  Q
    |||||||||| |||| |||||| ||||||||||||||||||||||  ||||||||||    
41973326 gtggtggccggggttcgaaccccggaccttgcatatattatgcattgtccctaccaa 41973270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 110 - 169
Target Start/End: Complemental strand, 12212364 - 12212305
Alignment:
110 ggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||| || ||||||||||| |||| ||||||||||||||||| ||||||||||| ||||    
12212364 ggtggtcggggtttgaaccccggacgttgcatatattatgcattatccctaccaaatgag 12212305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 16033440 - 16033518
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggaca 184  Q
    ||||||||||  ||||||||||  |||||||||||||||||||||  |||||| ||||||||   ||||||||||||||    
16033440 gtggtggccggagtttgaaccccagaccttgcatatattatgcattgtccctatcaactgagtcaagctcacgaggaca 16033518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 119 - 170
Target Start/End: Complemental strand, 17284011 - 17283960
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||| |||||||||||||||||||||||||||||  ||| ||||||||||||    
17284011 ggttcgaaccctggaccttgcatatattatgcattgtccttaccaactgagc 17283960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 119 - 183
Target Start/End: Original strand, 21400024 - 21400090
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||| ||||||  |||||||||||||||||||||  ||||||||||||||||  |||||||||||||    
21400024 ggttcgaacccaagaccttgcatatattatgcattgtccctaccaactgagctaagctcacgaggac 21400090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 8 - 87
Target Start/End: Complemental strand, 31798393 - 31798313
Alignment:
8 tattgaaaagtgaaatgagtcaannnnnnngggacaatattttttt-gcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||  |||||       |||||||||||||||| |||||||||||||||||||||| |||| ||||||    
31798393 tattgaaaagtgaaataggtcaattttcccgggacaatattttttttgcaaatgactcagttattatggaacggtgggagt 31798313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 120 - 184
Target Start/End: Original strand, 41769817 - 41769883
Alignment:
120 gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| |||||||| ||||||||||||| ||||  |||||||||||  ||||||||||||||    
41769817 gtttgaaccccggaccttggatatattatgcattatccaaaccaactgagctaagctcacgaggaca 41769883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 167
Target Start/End: Complemental strand, 46707943 - 46707884
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactg 167  Q
    ||||||||||| |||||||||| ||| ||||||||||||||||||  ||| |||||||||    
46707943 gtggtggccgatgtttgaaccccggaacttgcatatattatgcattgtccttaccaactg 46707884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 119 - 170
Target Start/End: Complemental strand, 50040416 - 50040365
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||||||||||||||||| ||||||||  |||| |||||||||||    
50040416 ggtttgaaccctggaccttgcatattttatgcattgtcccaaccaactgagc 50040365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 53 - 87
Target Start/End: Complemental strand, 7787603 - 7787569
Alignment:
53 tgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||||||||||||||||||    
7787603 tgcaaatgactcagttattatgggacggagggagt 7787569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 166
Target Start/End: Original strand, 8210375 - 8210433
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaact 166  Q
    |||||||||| |||| ||||||||||||||| |||||||||||||  ||| ||||||||    
8210375 gtggtggccggggttcgaaccctggaccttgtatatattatgcattgtccttaccaact 8210433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 8269358 - 8269420
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||| || ||||||||||| ||||||||||||||||||| ||  ||| ||||||||||||    
8269358 gtggtggtcggggtttgaaccccggaccttgcatatattatgtattgtccttaccaactgagc 8269420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 38 - 80
Target Start/End: Complemental strand, 8773183 - 8773141
Alignment:
38 gggacaatatttttttgcaaatgactcagttattatgggacgg 80  Q
    |||||| | ||||||||||||||||||||||||||||||||||    
8773183 gggacactttttttttgcaaatgactcagttattatgggacgg 8773141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 119 - 169
Target Start/End: Original strand, 32497482 - 32497532
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||||| |||||||||||||||||||||  | |||||||||||||    
32497482 ggtttgaaccctagaccttgcatatattatgcattgttcctaccaactgag 32497532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 35474023 - 35473961
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||| ||| |||| |||||||| |||||||||||||||||||| |||| |||||| |||||    
35474023 gtggtgtccggggttcgaaccctgaaccttgcatatattatgcattatccttaccaattgagc 35473961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 51503750 - 51503688
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||  ||| ||||||| ||||||| |||||||||||||  ||||||||||||||||    
51503750 gtggtggccggcgttcgaaccctagaccttggatatattatgcattgtccctaccaactgagc 51503688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 108 - 165
Target Start/End: Complemental strand, 8736506 - 8736449
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaac 165  Q
    |||||||||| ||||||||||| ||||||||||||| ||||||||  ||| |||||||    
8736506 gtggtggccggggtttgaaccccggaccttgcatattttatgcattgtccataccaac 8736449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 119 - 168
Target Start/End: Original strand, 12268985 - 12269034
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga 168  Q
    ||||||||||| ||||||||||||||||||||||  | ||||||||||||    
12268985 ggtttgaaccccggaccttgcatatattatgcattgttcctaccaactga 12269034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 38 - 87
Target Start/End: Original strand, 28424415 - 28424464
Alignment:
38 gggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||| |||||||||| ||||||||| ||| |||||||||    
28424415 gggacaatattttttggcaaatgactaagttattataggatggagggagt 28424464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 32962634 - 32962573
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||| || ||||||||||||||||||||||||| ||||||||  | | |||||||||||    
32962634 gtggtggtcggggtttgaaccctggaccttgcatattttatgcattgttcataccaactgag 32962573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 38 - 87
Target Start/End: Original strand, 36326351 - 36326400
Alignment:
38 gggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||| |||||| || |||||||||| ||||||||||||    
36326351 gggacaatatttttttacaaatggcttagttattatgagacggagggagt 36326400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 38 - 87
Target Start/End: Original strand, 46363574 - 46363623
Alignment:
38 gggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||| || ||| |||||||||||||||||||||| ||||||    
46363574 gggacaatattttattacaattgactcagttattatgggacggcgggagt 46363623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 129 - 169
Target Start/End: Original strand, 2889937 - 2889977
Alignment:
129 ctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||||||||||||||||||||  |||||||||||||||    
2889937 ctggaccttgcatatattatgcattgtccctaccaactgag 2889977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 87
Target Start/End: Original strand, 3160920 - 3160964
Alignment:
43 aatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||| |||| ||||||||||||||||||| |||||||    
3160920 aatatttttttgtaaataactcagttattatgggacgcagggagt 3160964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 10587754 - 10587794
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||| ||||||||||||||||||||||||| |||||    
10587754 tttttttgctaatgactcagttattatgggacggaaggagt 10587794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 133 - 169
Target Start/End: Original strand, 19396206 - 19396242
Alignment:
133 accttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||||||||||||| ||||||||||||||||    
19396206 accttgcatatattatgcattatccctaccaactgag 19396242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 24752637 - 24752716
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcata-tattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| |||| ||||||  ||||||||||| ||||||||||  ||| ||||||||||||  ||||||||||||||    
24752637 gtggtggccggggttcgaaccccagaccttgcatattattatgcattgtccataccaactgagctaagctcacgaggaca 24752716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 32950751 - 32950795
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||| |||||||||||| | ||||||||||||||||||||||    
32950751 gtggtggtcgaggtttgaactccggaccttgcatatattatgcat 32950795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 185
Target Start/End: Original strand, 33020033 - 33020112
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacag 185  Q
    |||||||| | ||||||||||   |||||||||||||||||||||  |||||||||  |||||  |||||||||||||||    
33020033 gtggtggctggggtttgaacctcagaccttgcatatattatgcattgtccctaccagttgagctaagctcacgaggacag 33020112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 168
Target Start/End: Complemental strand, 41974832 - 41974772
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga 168  Q
    |||||||||| ||||||||||    |||||||||||||||||||| ||||||| |||||||    
41974832 gtggtggccggggtttgaacctcaaaccttgcatatattatgcattatccctatcaactga 41974772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 121 - 169
Target Start/End: Original strand, 48264474 - 48264522
Alignment:
121 tttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||| ||||||||||||||| |||||||| |||| |||||||||||    
48264474 tttgaactctggaccttgcatattttatgcattatccataccaactgag 48264522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 3509931 - 3509993
Alignment:
108 gtggtggccgaggtttgaa-ccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||| ||||||| ||| ||||||||||||||||||||||  ||| ||||||||||||    
3509931 gtggtggccga-gtttgaacccccggaccttgcatatattatgcattgtccataccaactgagc 3509993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 109 - 164
Target Start/End: Complemental strand, 8094111 - 8094056
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaa 164  Q
    ||||||||| ||||| ||||| | ||||||||||||||||||||| ||| ||||||    
8094111 tggtggccggggtttaaaccccgcaccttgcatatattatgcatcgtccataccaa 8094056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 19620647 - 19620569
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||| || || ||||||||| ||||||||||||||||||| ||  ||| ||||||||||||  |||||||| |||||    
19620647 gtggtgtccaagatttgaaccccggaccttgcatatattatgtattgtccttaccaactgagctaagctcacggggaca 19620569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 119 - 170
Target Start/End: Original strand, 26803452 - 26803503
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||| |||| |||||||||||||||||  ||| ||||||||||||    
26803452 ggtttgaaccccggactttgcatatattatgcattgtccataccaactgagc 26803503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 56 - 87
Target Start/End: Original strand, 36057796 - 36057827
Alignment:
56 aaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||||||||||||||||    
36057796 aaatgactcagttattatgggacggagggagt 36057827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 40 - 83
Target Start/End: Original strand, 36232954 - 36232997
Alignment:
40 gacaatatttttttgcaaatgactcagttattatgggacggagg 83  Q
    |||||||||||||| |||||||||||||| |||||| |||||||    
36232954 gacaatatttttttacaaatgactcagttgttatggaacggagg 36232997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 120 - 184
Target Start/End: Complemental strand, 36679649 - 36679583
Alignment:
120 gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| |||||||||||||||||| |||  |||| | |||||||||  ||||||||||||||    
36679649 gtttgaaccccggaccttgcatatattatccattgtcccgatcaactgagccaagctcacgaggaca 36679583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 119 - 183
Target Start/End: Original strand, 37944131 - 37944197
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggac 183  Q
    ||||||||||||||| ||| |||||||||||||| |||| |||||| ||||   |||||||||||||    
37944131 ggtttgaaccctggatcttacatatattatgcattatccttaccaattgagataagctcacgaggac 37944197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #70
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 119 - 170
Target Start/End: Complemental strand, 44243933 - 44243882
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||| ||||||||| ||||||||||||||  | ||||||||||||||    
44243933 ggtttgaactctggaccttacatatattatgcattgttcctaccaactgagc 44243882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #71
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 135 - 170
Target Start/End: Complemental strand, 51370617 - 51370582
Alignment:
135 cttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||||||||||||||| ||||||||||||    
51370617 cttgcatatattatgcatcatccttaccaactgagc 51370582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #72
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 52441501 - 52441579
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| ||||  ||| | ||||||||||||||||||||||  ||  ||||||||||||  ||||||||||||||    
52441501 gtggtggccggggttcaaacgccggaccttgcatatattatgcattgtctataccaactgagctaagctcacgaggaca 52441579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #73
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 45 - 87
Target Start/End: Original strand, 2246465 - 2246507
Alignment:
45 tatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||||||||||| || |||||| |||||    
2246465 tatttttttgcaaatgactcagttattttgtgacggatggagt 2246507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #74
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 2 - 80
Target Start/End: Original strand, 5115952 - 5116031
Alignment:
2 atgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttg-caaatgactcagttattatgggacgg 80  Q
    ||||| |||||||||||||||||| ||||       ||||||||||||||||  ||||||| ||||||||||||| ||||    
5115952 atgttatattgaaaagtgaaatgaatcaatattattgggacaatattttttttacaaatgattcagttattatggaacgg 5116031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #75
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 111 - 169
Target Start/End: Original strand, 7574111 - 7574169
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||| |||||||||||| | ||||||||||||| |||||||  ||| |||||||||||    
7574111 gtggctgaggtttgaaccattgaccttgcatatactatgcattgtccttaccaactgag 7574169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #76
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 12783691 - 12783753
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||||||| ||||| | ||||| |||||||||||||||  ||| |||||| |||||    
12783691 gtggtggccgaggttcgaaccttagacctcgcatatattatgcattgtccataccaattgagc 12783753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #77
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 111 - 186
Target Start/End: Complemental strand, 13054941 - 13054864
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacaga 186  Q
    |||| ||||||| |||||   |||||||||||||||||||||  |||||||||||| |||  ||||||| ||||||||    
13054941 gtggtcgaggttcgaacctccgaccttgcatatattatgcattgtccctaccaactaagctaagctcacaaggacaga 13054864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #78
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 47 - 81
Target Start/End: Original strand, 19533091 - 19533125
Alignment:
47 tttttttgcaaatgactcagttattatgggacgga 81  Q
    |||||||||||||||||||||||||| ||||||||    
19533091 tttttttgcaaatgactcagttattacgggacgga 19533125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #79
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 109 - 147
Target Start/End: Original strand, 19795107 - 19795145
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatatta 147  Q
    ||||||||| ||||||||||| |||||||||||||||||    
19795107 tggtggccggggtttgaaccccggaccttgcatatatta 19795145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #80
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 38 - 87
Target Start/End: Original strand, 25983789 - 25983839
Alignment:
38 gggacaatatttttttgc-aaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||| | |||||||||| ||||||| |||||||||||||    
25983789 gggacaatattttttttccaaatgactcacttattataggacggagggagt 25983839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #81
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 169
Target Start/End: Complemental strand, 29800593 - 29800543
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||||  |||||||||||| |||||||| |||| |||||||||||    
29800593 ggtttgaacccccgaccttgcatattttatgcattatccttaccaactgag 29800543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #82
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 169
Target Start/End: Original strand, 33153881 - 33153931
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||||||  ||||||| ||||||||||||||  |||||||||||||||    
33153881 ggtttgaacctcggaccttacatatattatgcattgtccctaccaactgag 33153931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #83
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 132 - 183
Target Start/End: Original strand, 37098495 - 37098548
Alignment:
132 gaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    ||||||||||||||||| |||  ||||||||||||||||  |||||||||||||    
37098495 gaccttgcatatattattcattgtccctaccaactgagctaagctcacgaggac 37098548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #84
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 124 - 170
Target Start/End: Original strand, 38448872 - 38448918
Alignment:
124 gaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||| ||||||||||||||||||||||  ||| ||||||||||||    
38448872 gaaccccggaccttgcatatattatgcattgtccttaccaactgagc 38448918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #85
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 42888646 - 42888584
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||| | |||| |||||| ||||||||||||| ||||||||  ||| ||||||||||||    
42888646 gtggtggcgggggttcgaaccccggaccttgcatattttatgcattgtccataccaactgagc 42888584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #86
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 45049014 - 45048927
Alignment:
1 aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaata-tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||| |||||||||||||       ||||||||| ||||||| ||||||| |||||||   ||||||||| |||||    
45049014 aatgttgtattgaaaattgaaatgagtcaaaattcttgggacaatattttttttacaaatgagtcagttaaactgggacggaaggagt 45048927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #87
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 81
Target Start/End: Original strand, 50773502 - 50773540
Alignment:
43 aatatttttttgcaaatgactcagttattatgggacgga 81  Q
    ||||||||||||||||||||| | |||||||||||||||    
50773502 aatatttttttgcaaatgacttaattattatgggacgga 50773540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #88
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 6000133 - 6000194
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||| ||| ||||||||||  ||||||||||||||||||||||  |||  ||||||||||    
6000133 gtggtgtccggggtttgaacctcggaccttgcatatattatgcattgtcctaaccaactgag 6000194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #89
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 145
Target Start/End: Original strand, 6423751 - 6423788
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatat 145  Q
    |||||||||| ||||||||||| |||||||||||||||    
6423751 gtggtggccggggtttgaaccccggaccttgcatatat 6423788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #90
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 9639807 - 9639868
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||| |||||||| |||| | ||||||||||||||||||||||  ||| |||||| ||||    
9639807 gtggtgtccgaggttcgaactccggaccttgcatatattatgcattgtccttaccaagtgag 9639868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #91
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 133 - 170
Target Start/End: Original strand, 9872120 - 9872157
Alignment:
133 accttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||||||||||||| |||| ||||||||||||    
9872120 accttgcatatattatgcattatccttaccaactgagc 9872157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #92
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 119 - 152
Target Start/End: Original strand, 9929232 - 9929265
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||| ||||||||||||||||||||||||||||    
9929232 ggttttaaccctggaccttgcatatattatgcat 9929265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #93
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 10356173 - 10356234
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||||||  ||| |||||| ||||| ||||||||||||||||  ||| |||||||||||    
10356173 gtggtggccggagttcgaaccccggaccgtgcatatattatgcattgtccataccaactgag 10356234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #94
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 165
Target Start/End: Complemental strand, 13778632 - 13778575
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaac 165  Q
    ||||||| |||||||||||||| | ||||||||||| |||||||| || | |||||||    
13778632 gtggtggtcgaggtttgaaccccgaaccttgcatattttatgcattattcataccaac 13778575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #95
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 113 - 170
Target Start/End: Original strand, 16533028 - 16533085
Alignment:
113 ggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||| |||||||| ||| |||||||||||||||||||||  | ||||||||| ||||    
16533028 ggccggggtttgaatcctagaccttgcatatattatgcattgttcctaccaaccgagc 16533085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #96
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 17669716 - 17669655
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||||||  |||||||||| | |||||||||||||||| |||  |||||| ||||||||    
17669716 gtggtggccggagtttgaaccccgaaccttgcatatattatacattgtccctatcaactgag 17669655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #97
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 121 - 170
Target Start/End: Complemental strand, 22346734 - 22346685
Alignment:
121 tttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||| ||||||||||||| |||||||| ||||  |||||||||||    
22346734 tttgaaccccggaccttgcatattttatgcattatccaaaccaactgagc 22346685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #98
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 9 - 79
Target Start/End: Original strand, 24131534 - 24131604
Alignment:
9 attgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacg 79  Q
    ||||||||||||||| ||||||       ||||||   ||||||| |||||||||||||||||||||||||    
24131534 attgaaaagtgaaataagtcaatttttctgggacatattttttttacaaatgactcagttattatgggacg 24131604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #99
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 124 - 169
Target Start/End: Complemental strand, 24631894 - 24631849
Alignment:
124 gaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||| |||| |||||||||||||||||| |||| |||||||||||    
24631894 gaaccttggatcttgcatatattatgcattatccttaccaactgag 24631849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #100
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 121 - 170
Target Start/End: Complemental strand, 25086541 - 25086492
Alignment:
121 tttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||| |||||||||||| ||||||||  ||| ||||||||||||    
25086541 tttgaaccctagaccttgcatattttatgcattgtccataccaactgagc 25086492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #101
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 26760135 - 26760054
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||||| ||||       ||||||||| |||||| |||||| |||| ||||||| |||||||| ||||    
26760135 ttgtattgaaaagtgaaatgaatcaatttttctgggacaata-ttttttacaaatggctcaattattataggacggagtgagt 26760054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #102
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 29042608 - 29042547
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||| || | ||||||||| ||| ||| |||||||||||||| ||||||||||| ||||    
29042608 gtggtggtcgggatttgaaccccggatcttacatatattatgcattatccctaccaattgag 29042547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #103
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 30382567 - 30382506
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||||||||||||| |  |||||||||||| ||||||||  |||  ||||||||||    
30382567 gtggtggccgaggtttgaacgccagaccttgcatattttatgcattgtccaaaccaactgag 30382506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #104
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 118 - 184
Target Start/End: Complemental strand, 30795762 - 30795694
Alignment:
118 aggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||| ||||| |||||||||||||||||||||||  | | ||||||||||||  || |||||||||||    
30795762 aggttcgaaccttggaccttgcatatattatgcattgttcttaccaactgagctaagttcacgaggaca 30795694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #105
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 38 - 87
Target Start/End: Complemental strand, 32347889 - 32347840
Alignment:
38 gggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||| |||| ||| ||||| || |||||||||||||||||||||||    
32347889 gggacaattttttattgaaaatggcttagttattatgggacggagggagt 32347840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #106
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 34766931 - 34766870
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||||||||||| ||||||  |||||||||| |||||| |||  ||| |||||||||||    
34766931 gtggtggccgaggttcgaaccccagaccttgcatgtattatacattgtccataccaactgag 34766870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #107
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 47719097 - 47719158
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||| | || |||| | | |||||||||||||||||||| |||| |||||||||||    
47719097 gtggtggccgggattcgaactccgaaccttgcatatattatgcattatccttaccaactgag 47719158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #108
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 64668 - 64712
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||| |||||||||||| | |||| |||||||||||||||||    
64668 gtggtggacgaggtttgaactccggactttgcatatattatgcat 64712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #109
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 79
Target Start/End: Original strand, 8903469 - 8903505
Alignment:
43 aatatttttttgcaaatgactcagttattatgggacg 79  Q
    ||||||||||||||||||| ||| |||||||||||||    
8903469 aatatttttttgcaaatgagtcatttattatgggacg 8903505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #110
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 168
Target Start/End: Original strand, 10132434 - 10132494
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga 168  Q
    |||||| || ||||| ||||||  |||||||||||||||||||||  ||| ||||||||||    
10132434 gtggtgtccaaggttcgaaccccagaccttgcatatattatgcattgtccttaccaactga 10132494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #111
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 121 - 169
Target Start/End: Original strand, 12852205 - 12852253
Alignment:
121 tttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||  || ||| |||||||||||||| ||||||||||||||||    
12852205 tttgaaccccagatcttacatatattatgcattatccctaccaactgag 12852253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #112
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 40 - 87
Target Start/End: Complemental strand, 16956325 - 16956280
Alignment:
40 gacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||||||||  ||| |||| ||||||||||||    
16956325 gacaatatttttttgcaaatgactc--ttactatgtgacggagggagt 16956280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #113
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 148
Target Start/End: Complemental strand, 23309538 - 23309498
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattat 148  Q
    ||||||| ||||||||||| ||| |||||||||||||||||    
23309538 gtggtggtcgaggtttgaagcctagaccttgcatatattat 23309498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #114
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 124 - 152
Target Start/End: Original strand, 23405364 - 23405392
Alignment:
124 gaaccctggaccttgcatatattatgcat 152  Q
    |||||||||||||||||||||||||||||    
23405364 gaaccctggaccttgcatatattatgcat 23405392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #115
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 121 - 169
Target Start/End: Complemental strand, 32561031 - 32560983
Alignment:
121 tttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||||| |||||||||||||||||| |||  ||| |||||||||||    
32561031 tttgaaccccggaccttgcatatattatacattgtccataccaactgag 32560983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #116
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 82
Target Start/End: Original strand, 35622909 - 35622985
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggag 82  Q
    |||||||||| ||||||||| |||||       |||||||||  |||||||||||| |||||||||||||| ||||||    
35622909 ttgtattgaagagtgaaatgtgtcaatttttttgggacaatagatttttgcaaatg-ctcagttattatggaacggag 35622985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #117
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 40613094 - 40613050
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||| |||| || |||||| ||||||||||||||||||||||    
40613094 gtggtggtcgagattcgaaccccggaccttgcatatattatgcat 40613050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #118
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 137 - 169
Target Start/End: Original strand, 41972749 - 41972781
Alignment:
137 tgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||||||||| ||||||||||||||||    
41972749 tgcatatattatgcattatccctaccaactgag 41972781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #119
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 47417854 - 47417810
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||| ||||||||||||| | | ||||||||||||||||||||    
47417854 gtggtgaccgaggtttgaactccgaaccttgcatatattatgcat 47417810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #120
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 185
Target Start/End: Original strand, 47528437 - 47528516
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacag 185  Q
    |||||| ||| |||| |||||  ||||||||| ||||||||||||  ||| ||||||||||||  |||||||| ||||||    
47528437 gtggtgtccggggttcgaacctcggaccttgcgtatattatgcattgtccttaccaactgagctaagctcacggggacag 47528516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #121
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 50269656 - 50269696
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||| ||  ||||||||||||||||||||||    
50269656 tttttttgcaaatggctatgttattatgggacggagggagt 50269696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #122
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 52432243 - 52432203
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||| |||||||||||  ||||||||||||||    
52432243 tttttttgcaaataactcagttattgagggacggagggagt 52432203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 115)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 6489078 - 6489000
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| |||||||||||  |||||||||||||||||||||  ||||||||||||||||  ||||||||||||||    
6489078 gtggtggccggggtttgaaccccagaccttgcatatattatgcattgtccctaccaactgagctaagctcacgaggaca 6489000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 15889482 - 15889405
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    ||||||| || |||||||||||| |||||||||||||||||||||  ||||||||||||||||  |||||||||||||    
15889482 gtggtggtcggggtttgaaccctagaccttgcatatattatgcattgtccctaccaactgagctaagctcacgaggac 15889405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 108 - 186
Target Start/End: Complemental strand, 34436922 - 34436842
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacaga 186  Q
    ||||||| || ||||||||||| || |||||||||||||||||||  ||||||||||||||||  ||||||||||||||||    
34436922 gtggtgggcggggtttgaaccccggcccttgcatatattatgcattgtccctaccaactgagctaagctcacgaggacaga 34436842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 22522791 - 22522869
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| ||||||||||| ||||||||||||||||||||||  ||| ||||||| ||||  ||||||||||||||    
22522791 gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccataccaaccgagctaagctcacgaggaca 22522869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 5 - 87
Target Start/End: Original strand, 4044606 - 4044689
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatattt-ttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||||| ||||       |||||| | ||| ||||||||||||||||||||||||||||||||||||||    
4044606 ttgtattgaaaagtgaaatgattcaattattttgggacattttttattttgcaaatgactcagttattatgggacggagggagt 4044689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 5485257 - 5485180
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    ||||||||| ||||| |||||| |||| |||||||||||||||||  ||||||||||||||||  |||||||||||||    
5485257 gtggtggccaaggttagaaccccggacattgcatatattatgcattgtccctaccaactgagctaagctcacgaggac 5485180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 111 - 168
Target Start/End: Complemental strand, 33412159 - 33412102
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga 168  Q
    ||||||| |||||||| |||||||||||||||||||||||||| | ||||||||||||    
33412159 gtggccggggtttgaatcctggaccttgcatatattatgcatctttcctaccaactga 33412102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 118 - 184
Target Start/End: Original strand, 35270681 - 35270749
Alignment:
118 aggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||||||||||||||||||| ||||||||  |||| |||||||||||  ||||||||||||||    
35270681 aggtttgaaccctggaccttgcatattttatgcattgtcccaaccaactgagctaagctcacgaggaca 35270749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 108 - 168
Target Start/End: Original strand, 22499113 - 22499173
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga 168  Q
    |||||||||||| ||||||||||| ||||||||||||||| |||| ||| |||||||||||    
22499113 gtggtggccgagttttgaaccctgaaccttgcatatattaagcattatcactaccaactga 22499173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 39 - 87
Target Start/End: Original strand, 36007053 - 36007101
Alignment:
39 ggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||| |||||||||||||||||||| ||||||||||||    
36007053 ggacaatatttttttacaaatgactcagttattatgagacggagggagt 36007101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 6624847 - 6624769
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| |||| |||||| ||||||||||||||||||||||  ||| | ||||||||||  ||||||||||||||    
6624847 gtggtggccggggttcgaaccccggaccttgcatatattatgcattgtccatgccaactgagctaagctcacgaggaca 6624769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 32565595 - 32565517
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||||| ||||||||||   ||||||| |||||||||||||| |||||||||| ||||||  ||||||||||||||    
32565595 gtggtggccaaggtttgaacttcggaccttacatatattatgcattatccctaccagctgagctaagctcacgaggaca 32565517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 111 - 183
Target Start/End: Complemental strand, 34191501 - 34191427
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    ||||||| ||||||||||| ||||||||||||| ||||||||  |||| |||||||||||  |||||||||||||    
34191501 gtggccggggtttgaaccccggaccttgcatattttatgcattgtcccaaccaactgagctaagctcacgaggac 34191427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 37932401 - 37932323
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||  |||| |||||| ||||||||||||||||||||||  ||| ||||||||||||  ||||||||||||||    
37932401 gtggtggccagggttcgaaccccggaccttgcatatattatgcattgtccataccaactgagctaagctcacgaggaca 37932323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 3445237 - 3445314
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||||| | ||||||||| |||||||||||| |||||||||  ||| ||||||||||||  |||||||||||||    
3445237 gtggtggccgggatttgaaccccggaccttgcatacattatgcattgtccttaccaactgagctaagctcacgaggac 3445314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 150
Target Start/End: Complemental strand, 14474905 - 14474863
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgc 150  Q
    |||||||||| ||||||||||||||||||||||||||||||||    
14474905 gtggtggccggggtttgaaccctggaccttgcatatattatgc 14474863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 17090937 - 17090875
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||| ||||||||||| |||||||||||  ||||||||| |||| ||||||||||||    
17090937 gtggtggccggggtttgaaccccggaccttgcattaattatgcattatccataccaactgagc 17090875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 40715939 - 40716016
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||||| ||||||||||| ||||||||||||||||||||||  ||| || ||| |||||  |||||||||||||    
40715939 gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccatatcaattgagctaagctcacgaggac 40716016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 5 - 79
Target Start/End: Complemental strand, 4194618 - 4194544
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacg 79  Q
    |||||||||||||||||||| || ||       ||||||||||||||||| ||||| ||||||||||||||||||    
4194618 ttgtattgaaaagtgaaatgggttaatttttctgggacaatatttttttgtaaatggctcagttattatgggacg 4194544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 11720964 - 11720904
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||| ||||||||||| | ||||||||||||||||||||  |||||||||||||||    
11720964 gtggtggccggggtttgaaccccg-accttgcatatattatgcattgtccctaccaactgag 11720904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 108 - 182
Target Start/End: Original strand, 16701571 - 16701647
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgagga 182  Q
    ||||||| || |||||||| || |||||||||||||||||| |||  ||||||||||||||||  ||||||||||||    
16701571 gtggtggtcggggtttgaatcccggaccttgcatatattattcattgtccctaccaactgagctaagctcacgagga 16701647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 25109995 - 25110081
Alignment:
1 aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||| ||||||||||       |  ||||||||||||||||||||| ||| ||||||| ||||||| |||||    
25109995 aatgttgtattgaaaagtggaatgagtcaaattttttgaaacaatatttttttgcaaatgattcacttattataggacggatggagt 25110081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 25169087 - 25169173
Alignment:
1 aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||| ||||||||||       |  ||||||||||||||||||||| ||| ||||||| ||||||| |||||    
25169087 aatgttgtattgaaaagtggaatgagtcaaattttttgaaacaatatttttttgcaaatgattcacttattataggacggatggagt 25169173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 34534902 - 34534820
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||| ||| ||||       ||||||||||||||||| ||||| |||| ||||||||||| |||||||||    
34534902 ttgtattgaaaagtgaactgaatcaatttttttgggacaatatttttttgtaaatggctcacttattatgggatggagggagt 34534820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 4009938 - 4009859
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatatt-atgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| ||||||||||| || ||||||||||||| ||||||  ||| ||||||||||||  ||||||||||||||    
4009938 gtggtggccggggtttgaaccccggcccttgcatatattaatgcattgtccttaccaactgagctaagctcacgaggaca 4009859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 6610771 - 6610731
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||| ||||||||||||||||||||||||||||||||    
6610771 tttttttgaaaatgactcagttattatgggacggagggagt 6610731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 110 - 182
Target Start/End: Complemental strand, 16094126 - 16094054
Alignment:
110 ggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagcagctcacgagga 182  Q
    ||||| || |||||||||||  || ||| |||||||||||||| ||||||| |||||||||| ||||||||||    
16094126 ggtggtcggggtttgaaccccagatcttacatatattatgcattatccctatcaactgagcaactcacgagga 16094054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 39 - 87
Target Start/End: Complemental strand, 16926379 - 16926331
Alignment:
39 ggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||| ||||||||||||||||||||||| ||| |||||    
16926379 ggacaatatttttttacaaatgactcagttattatgggatggaaggagt 16926331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 119 - 184
Target Start/End: Complemental strand, 24408555 - 24408488
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||||  |||||||||||||||||||||| |||  |||||||||||  ||||||||||||||    
24408555 ggtttgaaccccagaccttgcatatattatgcatcgtccaaaccaactgagctaagctcacgaggaca 24408488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 108 - 181
Target Start/End: Complemental strand, 39980579 - 39980504
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgagg 181  Q
    ||||||| || ||||||||| | ||||||||||||| |||||||| |||| ||||||||||||  |||||||||||    
39980579 gtggtggtcggggtttgaactccggaccttgcatattttatgcattatccataccaactgagctaagctcacgagg 39980504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 3 - 75
Target Start/End: Complemental strand, 5072932 - 5072860
Alignment:
3 tgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgg 75  Q
    ||||||||||||||||||||||  ||||       || |||||||||||| ||||||||||||||||||||||    
5072932 tgttgtattgaaaagtgaaatggatcaatttttttggaacaatattttttagcaaatgactcagttattatgg 5072860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 109 - 152
Target Start/End: Complemental strand, 25979914 - 25979871
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||||||||||||||||| |||||||||||| |||||||||    
25979914 tggtggccgaggtttgaaccccggaccttgcatacattatgcat 25979871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 31708136 - 31708214
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagca--gctcacgaggaca 184  Q
    |||||| |||||||| ||||||  |||||||||||||||||||||  | | |||||||||||||  |||||||||||||    
31708136 gtggtgtccgaggttcgaaccccagaccttgcatatattatgcattgttcataccaactgagcaatgctcacgaggaca 31708214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 132 - 170
Target Start/End: Complemental strand, 11017223 - 11017185
Alignment:
132 gaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||||||||||||| |||||||||||||||||    
11017223 gaccttgcatatattatgcattatccctaccaactgagc 11017185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 17862050 - 17861988
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||| |||  ||||||||||| || |||||||||||||||||  ||||||||||||||||    
17862050 gtggtggacgaaatttgaaccctgaactttgcatatattatgcattgtccctaccaactgagc 17861988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 133 - 184
Target Start/End: Original strand, 20370145 - 20370198
Alignment:
133 accttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||| ||||||||||||| |||||||||||||||||  ||||||||||||||    
20370145 accttgtatatattatgcattatccctaccaactgagctaagctcacgaggaca 20370198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 26655535 - 26655473
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||| |||| |||||| ||||||| ||||||||||||||  ||| ||||||||||||    
26655535 gtggtggccggggttcgaaccccggaccttacatatattatgcattgtccataccaactgagc 26655473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 26927120 - 26927058
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||| |||| |||||| ||||||| ||||||||||||||  ||| ||||||||||||    
26927120 gtggtggccggggttcgaaccccggaccttacatatattatgcattgtccataccaactgagc 26927058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 112 - 169
Target Start/End: Original strand, 979819 - 979876
Alignment:
112 tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||| |||||||||||| ||| |||||||||||||||||| || ||| ||||||||    
979819 tggccggggtttgaaccctagacgttgcatatattatgcatcgtctctatcaactgag 979876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 3725165 - 3725083
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||||| |||         ||||| | |||| |||||||||| |||||||||||||||||||||||||    
3725165 ttgtattgaaaagtgaaatgactcagttattttaggacacttttttattgcaaatgattcagttattatgggacggagggagt 3725083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 38 - 83
Target Start/End: Complemental strand, 4475190 - 4475145
Alignment:
38 gggacaatatttttttgcaaatgactcagttattatgggacggagg 83  Q
    ||||||||||||| | |||||||||||||||||| |||||||||||    
4475190 gggacaatattttatagcaaatgactcagttattttgggacggagg 4475145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 15898170 - 15898088
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||| ||||||       |  |||||||||||||||||||  |||||||||||||||| | |||||||    
15898170 ttgtattgaaaagtgaaataagtcaatttttctgaaacaatatttttttgcaaatagctcagttattatgggatgaagggagt 15898088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 31090282 - 31090201
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||||||| |        |||||||| ||||||||| ||||||||| |||||||||||| ||||||||    
31090282 ttgtattgaaaagtgaaatgagttatttttactgggacaat-tttttttgcgaatgactcaattattatgggacagagggagt 31090201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 109 - 183
Target Start/End: Original strand, 32200438 - 32200514
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||| || || |||||||| ||||||||||||||||||||||  |||||  |||||||||  |||||||||||||    
32200438 tggtggtcggggcttgaaccccggaccttgcatatattatgcattgtccctgtcaactgagctaagctcacgaggac 32200514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 83
Target Start/End: Original strand, 39061084 - 39061162
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagg 83  Q
    ||||||||||||||||||||| ||||         ||||||||||||||| |||||| ||||||||||||||| |||||    
39061084 ttgtattgaaaagtgaaatgaatcaatttttctatgacaatatttttttgtaaatgattcagttattatgggatggagg 39061162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 111 - 152
Target Start/End: Complemental strand, 42473962 - 42473921
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||| ||||||||||| ||||||||||||||||||||||    
42473962 gtggccgtggtttgaaccccggaccttgcatatattatgcat 42473921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 6629552 - 6629592
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||| ||||||||||||| ||||||||||||    
6629552 tttttttgcaaatggctcagttattatgagacggagggagt 6629592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 39 - 87
Target Start/End: Original strand, 16926253 - 16926301
Alignment:
39 ggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||| ||||||  |||||||||||||||||||| ||||    
16926253 ggacaatatttttttacaaatggatcagttattatgggacggagagagt 16926301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 22583044 - 22583084
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||| ||||||| |||||||||||||||    
22583044 tttttttgcaaatgacttagttattgtgggacggagggagt 22583084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 109 - 186
Target Start/End: Complemental strand, 25509381 - 25509302
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggacaga 186  Q
    |||||||||||||| |||||  |||||||||||||  |||||||  ||||||| |||||||   ||||||||||||||||    
25509381 tggtggccgaggttcgaacctcggaccttgcatattatatgcattgtccctactaactgagttaagctcacgaggacaga 25509302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 25814296 - 25814256
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||| |||||||||||||||||||| |||||    
25814296 tttttttgcaaatgtctcagttattatgggacggatggagt 25814256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 148
Target Start/End: Complemental strand, 27086149 - 27086109
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattat 148  Q
    |||||||| | ||||||||||||||||||||||||||||||    
27086149 gtggtggctggggtttgaaccctggaccttgcatatattat 27086109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 39008066 - 39008026
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||| ||||||||||| |||||||||||||||    
39008066 tttttttgcaaataactcagttattgtgggacggagggagt 39008026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 41184041 - 41184001
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||| ||||||||||||||||||||||| |||||||||    
41184041 ttttttttcaaatgactcagttattatgggagggagggagt 41184001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 42817102 - 42817146
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||| |||||||||||||| |||||||| |||||||||||||    
42817102 gtggtggtcgaggtttgaaccccggaccttgtatatattatgcat 42817146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 120 - 184
Target Start/End: Complemental strand, 2839857 - 2839791
Alignment:
120 gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| | |||||| ||||||||||||| ||||  |||||||||||  ||||||||||||||    
2839857 gtttgaaccccgaaccttggatatattatgcattatccaaaccaactgagctaagctcacgaggaca 2839791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 111 - 170
Target Start/End: Original strand, 10704324 - 10704383
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||  |||||||||| ||||||||||||| ||||||||  ||| ||||||||||||    
10704324 gtggccgtagtttgaaccccggaccttgcatattttatgcattgtccataccaactgagc 10704383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 13220611 - 13220688
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||| |||| ||||||||||| | || |||| ||||||||||||| ||| ||||||||||||  ||||||||||||||    
13220611 gtggttgccggggtttgaaccc-gaactttgcgtatattatgcatcgtccttaccaactgagctaagctcacgaggaca 13220688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 18331778 - 18331700
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| || |||||||| ||||||||||||| ||||||||  ||| |||||| |||||  ||||||| ||||||    
18331778 gtggtggccggggcttgaaccccggaccttgcatattttatgcattgtccataccaagtgagctaagctcacaaggaca 18331700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 133 - 185
Target Start/End: Complemental strand, 20211326 - 20211272
Alignment:
133 accttgcatatattatgcatcatccctaccaactgag--cagctcacgaggacag 185  Q
    ||||||||||||||||| || ||||||||||||||||   |||||||||||||||    
20211326 accttgcatatattatgtattatccctaccaactgagataagctcacgaggacag 20211272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 28207203 - 28207125
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| | || |||||  ||||||||||||| ||||||||  ||| ||||||||||||  ||||||||||||||    
28207203 gtggtggccgggattcgaacctcggaccttgcatattttatgcattgtccataccaactgagctaagctcacgaggaca 28207125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #62
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 37614417 - 37614495
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||||||| |||||||||  | |||||||||||||||||| |  || |||||||||||||  ||||||||| ||||    
37614417 gtggtggccgaagtttgaacctcgaaccttgcatatattatgcgttgtctctaccaactgagctaagctcacgacgaca 37614495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #63
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 47 - 86
Target Start/End: Original strand, 39212746 - 39212785
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggag 86  Q
    |||||||||||||| |||||||||| ||||||||||||||    
39212746 tttttttgcaaatggctcagttattttgggacggagggag 39212785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #64
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 169
Target Start/End: Original strand, 866028 - 866078
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||||||| ||||||||||||| |||| ||| |||| |||||||||||    
866028 ggtttgaaccccggaccttgcatattttatacattatccataccaactgag 866078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #65
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 169
Target Start/End: Complemental strand, 3671278 - 3671228
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||| ||||||||||||||||||||||||| ||| |||| || ||||||||    
3671278 ggttcgaaccctggaccttgcatatattatacattatccttatcaactgag 3671228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #66
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 165
Target Start/End: Original strand, 6424904 - 6424950
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaac 165  Q
    ||||||||||| |||||||| |||||||||||||  |||||||||||    
6424904 ggtttgaaccccggaccttgtatatattatgcattgtccctaccaac 6424950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #67
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 47 - 85
Target Start/End: Complemental strand, 7276320 - 7276282
Alignment:
47 tttttttgcaaatgactcagttattatgggacggaggga 85  Q
    |||||||||||||| |||||||||| |||||||||||||    
7276320 tttttttgcaaatggctcagttattttgggacggaggga 7276282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #68
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 11844428 - 11844490
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||| |||| || |||||||  ||||||||||||||||||||  ||| ||||||||||||    
11844428 gtggtggtcgagattcgaaccctaaaccttgcatatattatgcattgtccttaccaactgagc 11844490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #69
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 120 - 183
Target Start/End: Original strand, 17210711 - 17210776
Alignment:
120 gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    ||||||||||   |||||||||||||||||||   ||||||||||||||||  |||||||||||||    
17210711 gtttgaaccccacaccttgcatatattatgcactgtccctaccaactgagctaagctcacgaggac 17210776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #70
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 18391671 - 18391609
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||| ||||||| |||||  ||||||||||||| ||||||||  ||| ||||||||||||    
18391671 gtggtggtcgaggttcgaacctcggaccttgcatattttatgcattgtccttaccaactgagc 18391609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #71
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 18789107 - 18789045
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||| | ||||||||||| | ||||||||||| ||||||||  || |||||||||||||    
18789107 gtggtggctggggtttgaaccccgaaccttgcatattttatgcattgtctctaccaactgagc 18789045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #72
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 169
Target Start/End: Complemental strand, 20258605 - 20258555
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||| ||| |||| |||||||||||||||||||| |||| |||||||||||    
20258605 ggttcgaatcctgcaccttgcatatattatgcattatccataccaactgag 20258555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #73
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 169
Target Start/End: Complemental strand, 20721110 - 20721060
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||||||| ||||||||||||||||||| ||  ||| |||||||||||    
20721110 ggtttgaaccccggaccttgcatatattatgtattgtccataccaactgag 20721060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #74
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 27679569 - 27679507
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||| ||| | ||||||||| | |||||||||||||||||||| |||  ||||||||||||    
27679569 gtggtgtccgggatttgaaccccgaaccttgcatatattatgcattatctttaccaactgagc 27679507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #75
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 87
Target Start/End: Complemental strand, 33012288 - 33012250
Alignment:
49 tttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||| ||||||||||||||||| ||||    
33012288 tttttgcaaatgactcggttattatgggacggagtgagt 33012250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #76
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 37021362 - 37021424
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||| || ||||||||||||| | |||||||||||||||||| ||||  ||||| |||||    
37021362 gtggtggtcggggtttgaaccctgaatcttgcatatattatgcattatccaaaccaattgagc 37021424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #77
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 37462182 - 37462106
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||||| ||||||||| | ||||||||||||| ||||||||  | |||||||||| |||  |||||||||||||    
37462182 gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac 37462106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #78
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 169
Target Start/End: Complemental strand, 38495202 - 38495152
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||||||| | ||||||||||| |||||||| |||| |||||||||||    
38495202 ggtttgaaccccgaaccttgcatattttatgcattatccataccaactgag 38495152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #79
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 5 - 87
Target Start/End: Original strand, 72235 - 72317
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||| |||||       ||||||||| ||||||||||||  ||  ||||||||| ||||| ||||||    
72235 ttgtattgaaaagtgaaatgggtcaatttttttgggacaatacttttttgcaaattgcttggttattatgtgacggtgggagt 72317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #80
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 112 - 169
Target Start/End: Complemental strand, 3389229 - 3389172
Alignment:
112 tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||| ||||||||||  || ||||||||||||||||||  ||| |||||||||||    
3389229 tggccgatgtttgaaccccagatcttgcatatattatgcattgtccataccaactgag 3389172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #81
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 109 - 170
Target Start/End: Complemental strand, 5846099 - 5846038
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||| ||| |||||||||||  ||| |||||||||||||||||  ||| ||||||||||||    
5846099 tggtgtccggggtttgaaccccagactttgcatatattatgcattgtccttaccaactgagc 5846038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #82
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 8350741 - 8350680
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||||| || ||||||| ||| |||||||||||||||||  ||| | |||||||||    
8350741 gtggtggccgagattcgaaccctagactttgcatatattatgcattgtccatgccaactgag 8350680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #83
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 109 - 170
Target Start/End: Original strand, 12909157 - 12909218
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||| |||||| ||||||| ||||| ||||||||||||||  | | ||||||||||||    
12909157 tggtggccaaggtttaaaccctgaaccttacatatattatgcattgttcataccaactgagc 12909218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #84
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 13864415 - 13864354
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||| || ||||||||||| ||||||||||||||||||| ||  | | |||||||||||    
13864415 gtggtggtcggggtttgaaccccggaccttgcatatattatgtattgttcataccaactgag 13864354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #85
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 133 - 170
Target Start/End: Original strand, 19068454 - 19068491
Alignment:
133 accttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||||||||||||| |||| ||||||||||||    
19068454 accttgcatatattatgcattatccataccaactgagc 19068491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #86
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 149
Target Start/End: Original strand, 21594376 - 21594417
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatg 149  Q
    ||||||||| || |||||||| ||||||||||||||||||||    
21594376 gtggtggccaagctttgaaccttggaccttgcatatattatg 21594417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #87
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 149
Target Start/End: Original strand, 21598493 - 21598534
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatg 149  Q
    ||||||||| || |||||||| ||||||||||||||||||||    
21598493 gtggtggccaagctttgaaccttggaccttgcatatattatg 21598534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #88
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 109 - 170
Target Start/End: Complemental strand, 26409323 - 26409262
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||| || |||| |||||| ||||||| ||||||||||||||  ||| ||||||||||||    
26409323 tggtgggcggggttcgaaccccggaccttacatatattatgcattgtccataccaactgagc 26409262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #89
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 110 - 184
Target Start/End: Complemental strand, 27219357 - 27219281
Alignment:
110 ggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||| ||||||||||||||| ||| ||||||||||| ||  || || | ||||||||  ||||||||||||||    
27219357 ggtggccggggtttgaaccctggatcttacatatattatgtattgtctctgctaactgagctaagctcacgaggaca 27219281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #90
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 122 - 184
Target Start/End: Original strand, 27721679 - 27721743
Alignment:
122 ttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||||  ||| |||||||||||||||||  | ||||||||||||||  ||||||||||||||    
27721679 ttgaaccccagactttgcatatattatgcattgttcctaccaactgagctaagctcacgaggaca 27721743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #91
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Complemental strand, 33654795 - 33654758
Alignment:
132 gaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||||||||||||||  |||||||||||||||    
33654795 gaccttgcatatattatgcattgtccctaccaactgag 33654758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #92
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 133 - 183
Target Start/End: Original strand, 36321509 - 36321561
Alignment:
133 accttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    ||||||||||||||||||||  ||| ||||||||||||  |||||||||||||    
36321509 accttgcatatattatgcattgtccttaccaactgagctaagctcacgaggac 36321561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #93
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 124 - 169
Target Start/End: Complemental strand, 43108624 - 43108579
Alignment:
124 gaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||| ||||||||||||||||||||  ||| |||||||||||    
43108624 gaaccctgaaccttgcatatattatgcattgtccttaccaactgag 43108579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #94
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 109 - 169
Target Start/End: Complemental strand, 1746049 - 1745989
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||| |||||||||||||||| || |||||||||||||| ||| |||  || ||||||||    
1746049 tggtgaccgaggtttgaacccttgatcttgcatatattatacattatctttaacaactgag 1745989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #95
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 168
Target Start/End: Complemental strand, 3052350 - 3052290
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga 168  Q
    ||||||| |||||||||||||  | |||||||||||||||| |||  ||||||||| ||||    
3052350 gtggtggtcgaggtttgaacctcgaaccttgcatatattatacattgtccctaccagctga 3052290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #96
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 83
Target Start/End: Complemental strand, 4412310 - 4412274
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagg 83  Q
    |||||||||||||||||  ||||||||||||||||||    
4412310 tttttttgcaaatgacttggttattatgggacggagg 4412274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #97
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 109 - 169
Target Start/End: Original strand, 5107236 - 5107296
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||| || |||| |||||  |||||||||||||||||||||| || | |||||||||||    
5107236 tggtggtcggggttcgaacctcggaccttgcatatattatgcattattcataccaactgag 5107296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #98
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 39 - 79
Target Start/End: Original strand, 5147644 - 5147684
Alignment:
39 ggacaatatttttttgcaaatgactcagttattatgggacg 79  Q
    ||||||||||||||||| ||||| ||||||||||| |||||    
5147644 ggacaatatttttttgctaatgattcagttattataggacg 5147684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #99
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 11099650 - 11099690
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||| ||||||||||||||| | |||||||||||    
11099650 tttttttgcaattgactcagttattatagaacggagggagt 11099690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #100
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 12611025 - 12611101
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc-agctcacgaggac 183  Q
    ||||||| ||||||| ||||||  |||||||||||| ||||||||  ||| |||||| ||||| | |||||||||||    
12611025 gtggtggtcgaggttcgaaccccagaccttgcatattttatgcattgtccataccaattgagcaaactcacgaggac 12611101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #101
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Complemental strand, 13044485 - 13044449
Alignment:
133 accttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||||||||||||| || |||||||||||||    
13044485 accttgcatatattatgcattattcctaccaactgag 13044449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #102
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Complemental strand, 13114483 - 13114447
Alignment:
133 accttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||||||||||||| || |||||||||||||    
13114483 accttgcatatattatgcattattcctaccaactgag 13114447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #103
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 87
Target Start/End: Complemental strand, 13716935 - 13716903
Alignment:
55 caaatgactcagttattatgggacggagggagt 87  Q
    |||||||||| ||||||||||||||||||||||    
13716935 caaatgactccgttattatgggacggagggagt 13716903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #104
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 19518590 - 19518634
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||| ||||||||||||||  | |||||||||||||||||||    
19518590 gtggtggtcgaggtttgaacccccggccttgcatatattatgcat 19518634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #105
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 166
Target Start/End: Original strand, 20145562 - 20145618
Alignment:
110 ggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaact 166  Q
    |||| |||||||| |||||| || ||||||||| ||||||||  |||||||||||||    
20145562 ggtgtccgaggttcgaaccccggcccttgcataaattatgcaatatccctaccaact 20145618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #106
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 20189824 - 20189784
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||| |||||||| ||||||| ||||    
20189824 tttttttgcaaatgactcacttattatgagacggagagagt 20189784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #107
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 184
Target Start/End: Complemental strand, 26166799 - 26166733
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||||||||||||||||||||| | ||||||  | || |||||||||||  ||||||||||||||    
26166799 ggtttgaaccctggaccttgcatatttgatgcattgt-ccgaccaactgagctaagctcacgaggaca 26166733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #108
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 31280090 - 31280046
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||| |||||||||||||| |||  |||||||||||||||||    
31280090 gtggtggtcgaggtttgaaccccggatattgcatatattatgcat 31280046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #109
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 32339806 - 32339762
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||| | || |||||| ||||||||||||||||||||||    
32339806 gtggtggccgggattcgaaccccggaccttgcatatattatgcat 32339762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #110
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 35334700 - 35334740
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||| ||| ||||||||||||||||||||||||||| ||||    
35334700 ttttattgaaaatgactcagttattatgggacggagagagt 35334740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #111
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 35413027 - 35412984
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||| |||| |||||| ||||||||||||||||||||||    
35413027 gtggtggccggggttcgaaccc-ggaccttgcatatattatgcat 35412984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #112
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 35646262 - 35646302
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||  |||||||||||||||| |||||||||    
35646262 tttttttgcaaatagctcagttattatgggatggagggagt 35646302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #113
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 87
Target Start/End: Complemental strand, 35988567 - 35988523
Alignment:
43 aatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||  ||||||||||||| ||||| |||||    
35988567 aatatttttttgcaaatggatcagttattatggaacggaaggagt 35988523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #114
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 36736811 - 36736855
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||||||||||| ||| | |||||| |||||||||||||    
36736811 gtggtggccgaggtttgagccccgaaccttgaatatattatgcat 36736855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #115
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 39060587 - 39060627
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||| ||| |||||||||| |||||||||||||||||||||    
39060587 ttttattgaaaatgactcaattattatgggacggagggagt 39060627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 46; Significance: 2e-17; HSPs: 74)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 109 - 183
Target Start/End: Complemental strand, 16390499 - 16390423
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggac 183  Q
    ||||||||||||||||||||| ||||||| ||||||||||||||  |||||||||||||||   |||||||||||||    
16390499 tggtggccgaggtttgaaccccggaccttacatatattatgcattgtccctaccaactgaggtaagctcacgaggac 16390423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 5 - 84
Target Start/End: Complemental strand, 4552880 - 4552801
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggaggg 84  Q
    ||||||||||||||||||||||||||       | ||||||||||||||||||||| ||| ||| |||||||||||||||    
4552880 ttgtattgaaaagtgaaatgagtcaatttttctgagacaatatttttttgcaaatggctcggtttttatgggacggaggg 4552801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 109 - 170
Target Start/End: Complemental strand, 33824951 - 33824890
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||||||||||||| ||||||||||||||||||||||  ||| || |||||||||    
33824951 tggtggccgaggtttgaaccccggaccttgcatatattatgcattgtccttatcaactgagc 33824890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 34915982 - 34916022
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||||||||||||||||||||||||    
34915982 tttttttgcaaatgactcagttattatgggacggagggagt 34916022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 8916464 - 8916542
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggaca 184  Q
    |||||||||||| ||||||| | ||||||||||||||||||| ||  |||||||||||||||   ||||||||||||||    
8916464 gtggtggccgagatttgaactccggaccttgcatatattatgtattgtccctaccaactgagtttagctcacgaggaca 8916542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 29740553 - 29740475
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| ||||||||||| ||||||||| ||||||||||||  ||| |||||| |||||  ||||||||||||||    
29740553 gtggtggccggggtttgaaccccggaccttgcgtatattatgcattgtccataccaattgagctaagctcacgaggaca 29740475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 17151307 - 17151230
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    ||||||||||||||||||||||  |||||||||||||||||| ||  || ||||||||| |||  |||||||||||||    
17151307 gtggtggccgaggtttgaaccccagaccttgcatatattatgtattgtcactaccaacttagctaagctcacgaggac 17151230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 119 - 168
Target Start/End: Complemental strand, 291427 - 291378
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga 168  Q
    ||||||||||| |||||||||||||||||||||| |||| ||||||||||    
291427 ggtttgaaccccggaccttgcatatattatgcatgatccataccaactga 291378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 8569780 - 8569719
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||| ||||||||||| ||||||||||||||||||||||  ||| |||||| ||||    
8569780 gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccataccaattgag 8569719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 121 - 170
Target Start/End: Original strand, 14917778 - 14917827
Alignment:
121 tttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||||| |||||||||||||||| ||| ||||||||||||||||    
14917778 tttgaaccctggtccttgcatatattatgtatcgtccctaccaactgagc 14917827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 119 - 184
Target Start/End: Original strand, 866286 - 866353
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| || ||||||||||||||||||||| | ||||||||||||||  | ||||||||||||    
866286 ggtttgaaccatgaaccttgcatatattatgcatcgtgcctaccaactgagctaaactcacgaggaca 866353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 47 - 83
Target Start/End: Original strand, 9755311 - 9755347
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagg 83  Q
    |||||||||||||||||||||||||||||||||||||    
9755311 tttttttgcaaatgactcagttattatgggacggagg 9755347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 9333802 - 9333724
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||||| ||| ||||| ||||||||||||||| ||||||  ||| |||||| |||||  ||||||||||||||    
9333802 gtggtggccgagatttaaaccccggaccttgcatatataatgcattgtccttaccaattgagctaagctcacgaggaca 9333724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 119 - 187
Target Start/End: Complemental strand, 20744198 - 20744128
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacagac 187  Q
    |||||||||||  |||||||||||||||||||||  ||| ||||||||||||  |||||||||||| ||||    
20744198 ggtttgaaccccagaccttgcatatattatgcattgtccataccaactgagctaagctcacgaggagagac 20744128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 28231415 - 28231493
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||||||  || ||||||| ||||||||||||||||||||||  |||||| |||||||||  ||||||| ||||||    
28231415 gtggtggccggagtgtgaaccccggaccttgcatatattatgcattgtccctatcaactgagccaagctcactaggaca 28231493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 115 - 182
Target Start/End: Complemental strand, 3640581 - 3640512
Alignment:
115 ccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgagga 182  Q
    |||||||| |||||| || ||||||||||| ||||||  |||||||||||||||||  ||||||||||||    
3640581 ccgaggttcgaaccccggcccttgcatatactatgcaatatccctaccaactgagctaagctcacgagga 3640512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 120 - 170
Target Start/End: Complemental strand, 8639105 - 8639055
Alignment:
120 gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||| |||||||||||||| ||||||| |||| ||||||||||||    
8639105 gtttgaaccccggaccttgcatatactatgcattatccataccaactgagc 8639055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 41 - 87
Target Start/End: Original strand, 15351548 - 15351594
Alignment:
41 acaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||| ||||||||||||||||| |||| ||||||||    
15351548 acaatatttttttgccaatgactcagttattataggactgagggagt 15351594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 41 - 87
Target Start/End: Original strand, 15372028 - 15372074
Alignment:
41 acaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||| |||||| ||||||||||||||||| ||||||||    
15372028 acaatatttttttacaaatggctcagttattatgggacagagggagt 15372074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 109 - 184
Target Start/End: Complemental strand, 32053858 - 32053781
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||  |||||||||  | ||||||||||||||||||||  ||| ||||||||||||  ||||||||||||||    
32053858 tggtggccggagtttgaaccacgaaccttgcatatattatgcattgtccataccaactgagctaagctcacgaggaca 32053781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 119 - 169
Target Start/End: Original strand, 32524421 - 32524471
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||||||||| |||||||||||||||||  |||||||||| ||||    
32524421 ggtttgaaccctggactttgcatatattatgcattgtccctaccaattgag 32524471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 2726407 - 2726468
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||| ||| |||| |||||| ||||||||||||||||||||||  ||| |||||||||||    
2726407 gtggtgaccggggttcgaaccccggaccttgcatatattatgcattgtccataccaactgag 2726468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 8629686 - 8629747
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||| |||||||||||||| | ||||||||||||||||||||  ||| |||||| ||||    
8629686 gtggtggtcgaggtttgaaccccgaaccttgcatatattatgcattgtccataccaattgag 8629747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 119 - 168
Target Start/End: Original strand, 8637438 - 8637487
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga 168  Q
    ||||||||||  ||||||||||||||||||||||  ||||||||||||||    
8637438 ggtttgaacctcggaccttgcatatattatgcattgtccctaccaactga 8637487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 8831277 - 8831217
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||||||||||| |||||| |||||||||||| |||||||||  ||| |||||||||||    
8831277 gtggtggccgaggtt-gaaccccggaccttgcataaattatgcattgtccttaccaactgag 8831217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 119 - 152
Target Start/End: Original strand, 18253340 - 18253373
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||||||||||||||||||||||||||||||    
18253340 ggtttgaaccctggaccttgcatatattatgcat 18253373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 28951470 - 28951409
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||||||||| ||| ||| ||||||||||||||||||||  | | |||||||||||    
28951470 gtggtggccgaggtttaaactctgaaccttgcatatattatgcattgttcataccaactgag 28951409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 38 - 87
Target Start/End: Original strand, 33921631 - 33921680
Alignment:
38 gggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||  ||||| ||||||||||| ||||||||||||||    
33921631 gggacaatatttttttaaaaatggctcagttattacgggacggagggagt 33921680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 87
Target Start/End: Original strand, 34803836 - 34803918
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||||||||  |||||       || ||||||||||||| ||| || ||||||||||||||||| ||||||||    
34803836 ttgtattgaaaagtgaaattggtcaatttttttggaacaatatttttttacaattggctcagttattatgggaccgagggagt 34803918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 111 - 184
Target Start/End: Original strand, 655742 - 655817
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||| |||| |||||| ||||||||||||||||||||||  ||  ||||||||||||  ||||||| ||||||    
655742 gtggccggggttcgaaccccggaccttgcatatattatgcattgtcgataccaactgagctaagctcacaaggaca 655817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 185
Target Start/End: Complemental strand, 788937 - 788858
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggacag 185  Q
    ||||||| || ||||||||| | | ||||||||||||||||||||  ||| |||||||||||   |||||||||||||||    
788937 gtggtggtcggggtttgaactccgaaccttgcatatattatgcattgtccttaccaactgagataagctcacgaggacag 788858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 33109309 - 33109269
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||  ||||||||||||||||||||||||||    
33109309 tttttttgcaaatagctcagttattatgggacggagggagt 33109269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 111 - 183
Target Start/End: Original strand, 331879 - 331953
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggac 183  Q
    |||||||||||||||| ||   ||||||||||||||||||||  || ||||||||||||   |||||||||||||    
331879 gtggccgaggtttgaatcccaaaccttgcatatattatgcattgtctctaccaactgagttaagctcacgaggac 331953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 119 - 187
Target Start/End: Complemental strand, 9977117 - 9977047
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggacagac 187  Q
    |||||||||||  ||||||||||||||||||||| |||| |||||| ||||   |||||| ||||||||||    
9977117 ggtttgaaccccagaccttgcatatattatgcattatccataccaattgagttaagctcaggaggacagac 9977047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 119 - 170
Target Start/End: Original strand, 14918301 - 14918352
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||||  ||||||| |||||||||||||  ||||||||||||||||    
14918301 ggtttgaaccccagaccttgtatatattatgcattgtccctaccaactgagc 14918352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 21847265 - 21847187
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| | || |||||| | ||||||||||||||||| ||  ||||||||||||||||  |||||| |||||||    
21847265 gtggtggccgggattcgaaccccgtaccttgcatatattatgtattgtccctaccaactgagctaagctcaagaggaca 21847187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 167
Target Start/End: Complemental strand, 24248236 - 24248177
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactg 167  Q
    ||||||| ||||| |||||||| ||||||| ||||||||||| || |||| |||||||||    
24248236 gtggtggtcgagggttgaaccccggaccttacatatattatgtattatccttaccaactg 24248177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 111 - 170
Target Start/End: Original strand, 26356074 - 26356133
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||  |||||||||| | ||||||||||||||||||||  |||| |||||||||||    
26356074 gtggccggagtttgaaccccgaaccttgcatatattatgcattgtcccaaccaactgagc 26356133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 27907941 - 27908019
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||||| |||||||||||  |||||||||||| |||||||| |||| |  |||||||||  |||| |||||||||    
27907941 gtggtggccggggtttgaaccccagaccttgcatattttatgcattatccttgtcaactgagctaagctaacgaggaca 27908019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 119 - 170
Target Start/End: Original strand, 30960054 - 30960105
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||| |||||||||||||||||||||||| ||||  ||| ||||||||||||    
30960054 ggttcgaaccctggaccttgcatatattaagcattgtccttaccaactgagc 30960105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 109 - 152
Target Start/End: Complemental strand, 34474297 - 34474254
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||||| |||| ||||| |||||||||||||||||||||||    
34474297 tggtggccggggttcgaaccatggaccttgcatatattatgcat 34474254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 247730 - 247654
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||||||| ||||||||| | ||||||||||||| ||||||||  | |||||||||| |||  |||||||||||||    
247730 gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac 247654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 4455586 - 4455648
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||| || |||||||||||  ||||||||||||||||||| |  ||| ||||||||||||    
4455586 gtggtggtcggggtttgaaccccagaccttgcatatattatgccttgtccataccaactgagc 4455648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 124 - 170
Target Start/End: Complemental strand, 7414387 - 7414341
Alignment:
124 gaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||| ||||||||||| ||||||  |||||||||||||||||    
7414387 gaaccctggcccttgcatataatatgcaatatccctaccaactgagc 7414341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 111 - 157
Target Start/End: Original strand, 8393745 - 8393791
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatattatgcatcatcc 157  Q
    ||||||| |||||||| |||||||||||||||| |||||||| ||||    
8393745 gtggccggggtttgaaacctggaccttgcatattttatgcattatcc 8393791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 10018470 - 10018409
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||  |||||||||| | ||||| |||||||||||||| || ||||||||||||||    
10018470 gtggtggccggagtttgaaccccgaaccttacatatattatgcattat-cctaccaactgagc 10018409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 87
Target Start/End: Original strand, 15321357 - 15321436
Alignment:
8 tattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||| ||||||||| ||||       ||||||||||| |||||||||| ||||| ||||||| |||| ||||||||    
15321357 tattgaaacgtgaaatgaatcaatatttctgggacaatattgttttgcaaataactcaattattataggactgagggagt 15321436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 121 - 183
Target Start/End: Original strand, 21029369 - 21029434
Alignment:
121 tttgaaccctggaccttgcatatattatgca-tcatccctaccaactgag--cagctcacgaggac 183  Q
    ||||||||| | ||||||||||||||||||| |  |||||||||||||||  ||||||||||||||    
21029369 tttgaaccccgaaccttgcatatattatgcatttgtccctaccaactgagctcagctcacgaggac 21029434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 132 - 170
Target Start/End: Original strand, 30639440 - 30639478
Alignment:
132 gaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||||||||||||||||| || ||||||||||||||    
30639440 gaccttgcatatattatgcattattcctaccaactgagc 30639478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 169
Target Start/End: Complemental strand, 31971589 - 31971539
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||||||  ||||||||||||||||||||||  ||| |||||||||||    
31971589 ggtttgaacctcggaccttgcatatattatgcattgtccttaccaactgag 31971539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #51
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 112 - 183
Target Start/End: Complemental strand, 33976311 - 33976239
Alignment:
112 tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    |||||| ||||||||||| ||||||||||||| ||||||||  | |||||||||| |||  |||||||||||||    
33976311 tggccggggtttgaaccccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac 33976239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #52
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 4467349 - 4467288
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||||||||||| |||  |||||||||||||| ||||||  ||| |||||| ||||    
4467349 gtggtggccgaggtttgagccccagaccttgcatatatcatgcattgtccttaccaattgag 4467288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #53
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 149
Target Start/End: Original strand, 10507518 - 10507559
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatg 149  Q
    ||||||||||| ||||||||||  ||||||||||||||||||    
10507518 gtggtggccgatgtttgaaccccagaccttgcatatattatg 10507559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #54
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 134 - 180
Target Start/End: Original strand, 10780123 - 10780171
Alignment:
134 ccttgcatatattatgcatcatccctaccaactgagc--agctcacgag 180  Q
    |||||||||||||||||||  ||||||||||||||||  ||||||||||    
10780123 ccttgcatatattatgcattgtccctaccaactgagctaagctcacgag 10780171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #55
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 121 - 183
Target Start/End: Complemental strand, 18256940 - 18256877
Alignment:
121 tttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac 183  Q
    ||||||||| ||||||||||||||||||||||  ||| || |||||||||  |||||||||||||    
18256940 tttgaaccc-ggaccttgcatatattatgcattgtccttatcaactgagctaagctcacgaggac 18256877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #56
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 24373700 - 24373761
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||| | |||||||||||  |||||||||||||||||||||  || ||||||| ||||    
24373700 gtggtggctggggtttgaacccctgaccttgcatatattatgcattgtctctaccaattgag 24373761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #57
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 120 - 169
Target Start/End: Complemental strand, 29283874 - 29283825
Alignment:
120 gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||||||| ||||||||||||||||| |||  || ||||||||||||    
29283874 gtttgaaccctagaccttgcatatattatacattgtctctaccaactgag 29283825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #58
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 39 - 75
Target Start/End: Complemental strand, 2657844 - 2657808
Alignment:
39 ggacaatatttttttgcaaatgactcagttattatgg 75  Q
    ||||||||||||||| ||||| |||||||||||||||    
2657844 ggacaatatttttttacaaataactcagttattatgg 2657808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #59
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 4450333 - 4450289
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||| ||||| || |||||| ||||||||||||||||||||||    
4450333 gtggtgaccgagattcgaaccccggaccttgcatatattatgcat 4450289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #60
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 184
Target Start/End: Complemental strand, 9111107 - 9111040
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||| |||||| ||||||||||||||||||||||  | | |||||||||| |  ||||||||||||||    
9111107 ggttcgaaccccggaccttgcatatattatgcattgttcataccaactgaactaagctcacgaggaca 9111040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #61
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 12184579 - 12184535
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||| | ||||||||  ||||||||||||||||||||||    
12184579 gtggtggccgggatttgaaccacggaccttgcatatattatgcat 12184535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #62
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 112 - 152
Target Start/End: Complemental strand, 12215820 - 12215780
Alignment:
112 tggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||| | ||||||||| ||||||||||||||||||||||    
12215820 tggccgtgatttgaaccccggaccttgcatatattatgcat 12215780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #63
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 184
Target Start/End: Original strand, 12333569 - 12333636
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||| ||| ||||||||||||||| ||||||||  ||| ||| ||||||||  ||||||||||||||    
12333569 ggtttaaactctggaccttgcatattttatgcattgtccatactaactgagctaagctcacgaggaca 12333636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #64
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 148
Target Start/End: Complemental strand, 12440734 - 12440694
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattat 148  Q
    ||||||| ||||||||||||||  |||||||||||||||||    
12440734 gtggtggtcgaggtttgaaccccagaccttgcatatattat 12440694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #65
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 12700411 - 12700455
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||| ||||  |||||| |||||||||||||||||||||    
12700411 gtggtggccggggttcaaaccctagaccttgcatatattatgcat 12700455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #66
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 121 - 169
Target Start/End: Original strand, 14429131 - 14429179
Alignment:
121 tttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||||| ||||||||||||| ||||| || ||||| ||||||||||    
14429131 tttgaaccccggaccttgcatattttatgtattatcccaaccaactgag 14429179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #67
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 82
Target Start/End: Complemental strand, 15081368 - 15081324
Alignment:
38 gggacaatatttttttgcaaatgactcagttattatgggacggag 82  Q
    |||||| | |||||| ||| |||||||||||||||||||||||||    
15081368 gggacacttttttttcgcagatgactcagttattatgggacggag 15081324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #68
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 15155806 - 15155762
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||| || |||||||||||  |||||||||||||||||||||    
15155806 gtggtggtcgtggtttgaaccccagaccttgcatatattatgcat 15155762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #69
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 15187134 - 15187090
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||| || ||||||||||  ||||||||||||||||||||||    
15187134 gtggtggtcggggtttgaacctcggaccttgcatatattatgcat 15187090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #70
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 15473472 - 15473516
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcat 152  Q
    ||||||| || ||||||||||  ||||||||||||||||||||||    
15473472 gtggtggtcggggtttgaacctcggaccttgcatatattatgcat 15473516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #71
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 111 - 184
Target Start/End: Complemental strand, 21296825 - 21296751
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||| | |||||||| |||||||||||||| ||||||||  |||| |||||||||||  | ||||||||||||    
21296825 gtggccgggatttgaacc-tggaccttgcatattttatgcattgtcccaaccaactgagctaaactcacgaggaca 21296751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #72
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 166
Target Start/End: Complemental strand, 28898925 - 28898869
Alignment:
110 ggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaact 166  Q
    |||||||| ||||||||| | ||||||| ||||||||||||||  ||| ||||||||    
28898925 ggtggccggggtttgaactccggacctttcatatattatgcattgtccttaccaact 28898869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #73
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 30064119 - 30064159
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||| ||||||| ||||||||||||||| |||||    
30064119 tttttttgcaattgactcaattattatgggacggaaggagt 30064159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #74
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 168
Target Start/End: Complemental strand, 34701218 - 34701158
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga 168  Q
    ||||||||||  |||||||||   |||||||||||||||||||||  | ||||||||||||    
34701218 gtggtggccggagtttgaacctcagaccttgcatatattatgcattgttcctaccaactga 34701158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0027 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0027
Description:

Target: scaffold0027; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 61560 - 61621
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||| ||||||||||||||||||| |||| ||||||||| |||| |||||||||||    
61560 gtggtggccggggtttgaaccctggaccttacatacattatgcattatccttaccaactgag 61621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 3)
Name: scaffold0007
Description:

Target: scaffold0007; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 5 - 83
Target Start/End: Complemental strand, 158005 - 157927
Alignment:
5 ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagg 83  Q
    |||||||||||||||||||| |||||         |||||||||||||||||||||||||||||||||| |||||||||    
158005 ttgtattgaaaagtgaaatgggtcaatttttttttgacaatatttttttgcaaatgactcagttattataggacggagg 157927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 221003 - 221065
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    ||||||| || |||||||||||| ||| |||||||||||||| || |||||||||||||||||    
221003 gtggtggtcggggtttgaaccctagactttgcatatattatgtattatccctaccaactgagc 221065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 50 - 87
Target Start/End: Complemental strand, 230189 - 230152
Alignment:
50 ttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||| |||||||||| ||||||||||||||||||||||    
230189 ttttacaaatgactcggttattatgggacggagggagt 230152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0155 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0155
Description:

Target: scaffold0155; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 40 - 87
Target Start/End: Original strand, 8117 - 8164
Alignment:
40 gacaatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||  ||| |||||||||||||||||||||||||||||    
8117 gacaatattttttaacaattgactcagttattatgggacggagggagt 8164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0038 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0038
Description:

Target: scaffold0038; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 31912 - 31990
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||||||  || ||||||| ||||||||||||||||||||||  |||||| |||||||||  ||||||| ||||||    
31912 gtggtggccggagtgtgaaccccggaccttgcatatattatgcattgtccctatcaactgagccaagctcactaggaca 31990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0247 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0247
Description:

Target: scaffold0247; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 120 - 170
Target Start/End: Original strand, 20989 - 21039
Alignment:
120 gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||| |||||||||| ||||||||| ||| |||||||||||||||||    
20989 gtttgaactctggaccttgtatatattatccattatccctaccaactgagc 21039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0238 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0238
Description:

Target: scaffold0238; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 119 - 169
Target Start/End: Complemental strand, 25449 - 25399
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||| |||||||||||||||||||||||||||||  ||| |||||||||||    
25449 ggttcgaaccctggaccttgcatatattatgcattgtccttaccaactgag 25399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0026 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0026
Description:

Target: scaffold0026; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 75396 - 75334
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||||| | || |||||| ||||||||||||||||||||||  ||| ||||||||||||    
75396 gtggtggccgggattcgaaccccggaccttgcatatattatgcattgtccttaccaactgagc 75334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 109 - 184
Target Start/End: Complemental strand, 185333 - 185256
Alignment:
109 tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||| ||| ||||||||||| ||| ||||||||| ||||||||  ||| ||||||||||||  ||||||||||||||    
185333 tggtgaccggggtttgaaccccggatcttgcatattttatgcattgtccataccaactgagctaagctcacgaggaca 185256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0126 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0126
Description:

Target: scaffold0126; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 124 - 169
Target Start/End: Original strand, 34894 - 34939
Alignment:
124 gaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    |||||||||||||||||||||||||||||  ||| |||||||||||    
34894 gaaccctggaccttgcatatattatgcattgtccttaccaactgag 34939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1149 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold1149
Description:

Target: scaffold1149; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 111 - 184
Target Start/End: Complemental strand, 2400 - 2325
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||| |||||||||||||   ||||||||||||||||||||  ||||||||||| ||||  ||||||||| ||||    
2400 gtggctgaggtttgaaccccaaaccttgcatatattatgcattgtccctaccaaccgagctaagctcacgacgaca 2325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0983 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0983
Description:

Target: scaffold0983; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 111 - 184
Target Start/End: Original strand, 3308 - 3383
Alignment:
111 gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    ||||||||||||||||||| | |||||||||||||||||  |  ||| ||||||||||||   |||||||||||||    
3308 gtggccgaggtttgaaccccgaaccttgcatatattatgtcttgtccttaccaactgagctatgctcacgaggaca 3383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0034 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0034
Description:

Target: scaffold0034; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 48 - 80
Target Start/End: Complemental strand, 97994 - 97962
Alignment:
48 ttttttgcaaatgactcagttattatgggacgg 80  Q
    |||||||||||||||||||||||||||||||||    
97994 ttttttgcaaatgactcagttattatgggacgg 97962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0028 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0028
Description:

Target: scaffold0028; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 152
Target Start/End: Original strand, 72777 - 72809
Alignment:
120 gtttgaaccctggaccttgcatatattatgcat 152  Q
    |||||||||||||||||||||||||||||||||    
72777 gtttgaaccctggaccttgcatatattatgcat 72809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0040 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0040
Description:

Target: scaffold0040; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 56854 - 56777
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca 184  Q
    |||||||| | |||||||| | ||||||||||||||||||| |||  ||| ||||||||||||  ||||||||||||||    
56854 gtggtggctggggtttgaaac-tggaccttgcatatattatacattgtccataccaactgagctaagctcacgaggaca 56777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 56 - 87
Target Start/End: Complemental strand, 394704 - 394673
Alignment:
56 aaatgactcagttattatgggacggagggagt 87  Q
    ||||||||||||||||||||||||||||||||    
394704 aaatgactcagttattatgggacggagggagt 394673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1127 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold1127
Description:

Target: scaffold1127; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 165
Target Start/End: Original strand, 1166 - 1212
Alignment:
119 ggtttgaaccctggaccttgcatatattatgcatcatccctaccaac 165  Q
    ||||||||||| ||||||||||||||||||||||  | |||||||||    
1166 ggtttgaaccccggaccttgcatatattatgcattgttcctaccaac 1212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0735 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0735
Description:

Target: scaffold0735; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 1599 - 1537
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||| | |||| |||||| ||||||||||||| ||||||||  ||| ||||||||||||    
1599 gtggtggcgggggttcgaaccccggaccttgcatattttatgcattgtccataccaactgagc 1537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0180 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0180
Description:

Target: scaffold0180; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 17802 - 17741
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||||| | ||||||||||| ||||||||||| ||||||||||  ||| ||||||||||||    
17802 gtggtggctggggtttgaaccc-ggaccttgcatgtattatgcattgtccataccaactgagc 17741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0118 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0118
Description:

Target: scaffold0118; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 186
Target Start/End: Complemental strand, 40062 - 39989
Alignment:
115 ccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacaga 186  Q
    ||||||||||||||    ||||||||||||||||||||  ||| ||||||||||||  |||||||||| |||||    
40062 ccgaggtttgaacctctaaccttgcatatattatgcattgtccataccaactgagctaagctcacgagcacaga 39989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 120 - 183
Target Start/End: Complemental strand, 99096 - 99031
Alignment:
120 gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggac 183  Q
    ||||||||||  |||||||||||||||||||||  |||||| ||||||||   |||||||||||||    
99096 gtttgaaccccagaccttgcatatattatgcattgtccctatcaactgagtcaagctcacgaggac 99031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 112 - 170
Target Start/End: Complemental strand, 239874 - 239816
Alignment:
112 tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc 170  Q
    |||||| ||||||||| | |||| |||||||||||||||||  ||| ||||||||||||    
239874 tggccggggtttgaactccggactttgcatatattatgcattgtccttaccaactgagc 239816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0143 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0143
Description:

Target: scaffold0143; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 121 - 166
Target Start/End: Complemental strand, 4524 - 4479
Alignment:
121 tttgaaccctggaccttgcatatattatgcatcatccctaccaact 166  Q
    |||||||||||||||||||||| |||||||||  |||||| |||||    
4524 tttgaaccctggaccttgcataaattatgcattgtccctatcaact 4479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0050 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0050
Description:

Target: scaffold0050; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 53370 - 53431
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||| || |||||||||||  |||||||||||| ||||||||  ||||| |||||||||    
53370 gtggtggtcggggtttgaaccccagaccttgcatattttatgcattgtcccttccaactgag 53431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0021 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0021
Description:

Target: scaffold0021; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 161212 - 161151
Alignment:
108 gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag 169  Q
    ||||||| || ||||||||||| | ||||||||||| ||||||||  ||| |||||||||||    
161212 gtggtggtcggggtttgaaccccgaaccttgcatattttatgcattgtccataccaactgag 161151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0045 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0045
Description:

Target: scaffold0045; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 26259 - 26219
Alignment:
47 tttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    |||||||||||||   |||||||||||||||||||||||||    
26259 tttttttgcaaattgttcagttattatgggacggagggagt 26219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0006 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: scaffold0006
Description:

Target: scaffold0006; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 87
Target Start/End: Original strand, 98822 - 98866
Alignment:
43 aatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||| |||| |||||||| |||||||||||||||||||| ||||    
98822 aatatattttagcaaatgattcagttattatgggacggagtgagt 98866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0006; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 87
Target Start/End: Original strand, 108100 - 108144
Alignment:
43 aatatttttttgcaaatgactcagttattatgggacggagggagt 87  Q
    ||||| |||| |||||||| |||||||||||||||||||| ||||    
108100 aatatattttagcaaatgattcagttattatgggacggagtgagt 108144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University