View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9378_low_4 (Length: 245)
Name: NF9378_low_4
Description: NF9378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9378_low_4 |
 |  |
|
| [»] scaffold0027 (1 HSPs) |
 |  |  |
|
| [»] scaffold0007 (3 HSPs) |
 |  |  |
|
| [»] scaffold0155 (1 HSPs) |
 |  |  |
|
| [»] scaffold0038 (1 HSPs) |
 |  |  |
|
| [»] scaffold0247 (1 HSPs) |
 |  |  |
|
| [»] scaffold0238 (1 HSPs) |
 |  |  |
|
| [»] scaffold0026 (1 HSPs) |
 |  |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
| [»] scaffold0126 (1 HSPs) |
 |  |  |
|
| [»] scaffold1149 (1 HSPs) |
 |  |  |
|
| [»] scaffold0983 (1 HSPs) |
 |  |  |
|
| [»] scaffold0034 (1 HSPs) |
 |  |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
| [»] scaffold0040 (1 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
| [»] scaffold1127 (1 HSPs) |
 |  |  |
|
| [»] scaffold0735 (1 HSPs) |
 |  |  |
|
| [»] scaffold0180 (1 HSPs) |
 |  |  |
|
| [»] scaffold0118 (1 HSPs) |
 |  |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
| [»] scaffold0143 (1 HSPs) |
 |  |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
| [»] scaffold0021 (1 HSPs) |
 |  |  |
|
| [»] scaffold0045 (1 HSPs) |
 |  |  |
|
| [»] scaffold0006 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 146)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 108 - 236
Target Start/End: Original strand, 4360634 - 4360762
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagcagctcacgaggacagacggagggagtactaaactatc |
207 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
4360634 |
gtggtcgccgaggtttgaaccctgcaccttgcatatattatgcatcatccctaccaactgagcagctcacgaggacggacagagggagtactaaactatc |
4360733 |
T |
 |
| Q |
208 |
gtatattggtattaaaaacatgtctctgc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4360734 |
gtatattggtattaaaaacatgtctctgc |
4360762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 50362129 - 50362207
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
50362129 |
gtggtggccaaggtttgaaccctggaccttgcatatattatgcattgtccctaccaactgagctaagctcacgaggaca |
50362207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 5 - 87
Target Start/End: Original strand, 20964423 - 20964505
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20964423 |
ttgtattgaaaagtgaaataggtcaatttttctgggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
20964505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 7230351 - 7230273
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| ||| |||||||||||| |||||||||||||| |
|
|
| T |
7230351 |
gtggtggccgaggtttgaaccccggaccttgcatatattatgcattgtccttaccaactgagctaagctcacgaggaca |
7230273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 28330770 - 28330688
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||| |||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28330770 |
ttgtattgaaaagtgaaatgggtcaatttttatgggacagtatttttttgcaaatgggtcagttattatgggacggagggagt |
28330688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 5 - 82
Target Start/End: Original strand, 36047230 - 36047308
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatattttt-ttgcaaatgactcagttattatgggacggag |
82 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36047230 |
ttgtattgaaaagtgaaatgagtcaatttttctgagacaatatttttcttgcaaatgactcagttattatgggacggag |
36047308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 53848310 - 53848229
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||| ||||| | |||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
53848310 |
ttgtattgaaaagtgaaatgggtcaattttct-gagacaatatttttttgcaaatgactcagttattatgggatggagggagt |
53848229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 119 - 183
Target Start/End: Original strand, 20799395 - 20799461
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
20799395 |
ggtttgaaccccggaccttgcatatattatgcattgtccctaccaactgagctaagctcacgaggac |
20799461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 12322744 - 12322667
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||| ||||||||||||| ||| |||||||||||||||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
12322744 |
gtggtggctgaggtttgaaccccggaacttgcatatattatgcattgtccgtaccaactgagctaagctcacgaggac |
12322667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 19588225 - 19588148
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |||||||| ||| |||||| ||||| ||||||||||||| |
|
|
| T |
19588225 |
gtggtggccggggtttgaaccctggaccttgcatattttatgcattgtccataccaattgagctaagctcacgaggac |
19588148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 23810020 - 23809943
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||||||| | ||| |||||||||||| ||||||||||||| |
|
|
| T |
23810020 |
gtggtggccggggtttgaaccctgaaccttgcatatattatgctttgtccataccaactgagctaagctcacgaggac |
23809943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 21318243 - 21318304
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||| || |||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
21318243 |
gtggtggtcggggtttgaaccctagaccttgcatatattatgcattgtccctaccaactgag |
21318304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 108 - 186
Target Start/End: Original strand, 24664981 - 24665061
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacaga |
186 |
Q |
| |
|
||||||| || |||| |||||| |||||||||||||||||||||| ||| |||||||||||| |||||||||||||||| |
|
|
| T |
24664981 |
gtggtggtcggggttcgaaccccggaccttgcatatattatgcattctccataccaactgagctaagctcacgaggacaga |
24665061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 44633138 - 44633052
Alignment:
| Q |
1 |
aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||||||| |||||| ||| |||||||| ||| ||||||||| |
|
|
| T |
44633138 |
aatgttgtattgaaaagtgaaatgagtcaagattcttgggactatatttttttacaaatggctccgttattataggatggagggagt |
44633052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 4360533 - 4360618
Alignment:
| Q |
1 |
aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||||||||| ||||| | ||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
4360533 |
aatgttgtattgaaaagtgaaattggtcaatttttt-gtgacaatatttttttgtaaatggctcagttattatgggacggagggagt |
4360618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 11949753 - 11949831
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||| || ||||||||||| |||||||||||||||||||||| ||| |||||||||||| |||||| ||||||| |
|
|
| T |
11949753 |
gtggtggtcggggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagctaagctcatgaggaca |
11949831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 23304006 - 23304084
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| |||| | |||| |||||||||||||||||||| | |||||||||||||||| |||||||||||||| |
|
|
| T |
23304006 |
gtggtggccggggttcgcaccccggaccttgcatatattatgccttgtccctaccaactgagctaagctcacgaggaca |
23304084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 38453336 - 38453258
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||| | |||| ||||||||||||||||||||||||||||| ||| | |||||||||| |||||||||||||| |
|
|
| T |
38453336 |
gtggtggctggggttcgaaccctggaccttgcatatattatgcattgtccatgccaactgagctaagctcacgaggaca |
38453258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 47386611 - 47386697
Alignment:
| Q |
1 |
aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttt--tttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47386611 |
aatgttgtattgaaa-gtgaaatgagtcaatttttt-gggacaatatttttttttgcaaatgactcacttattatgggacggagggagt |
47386697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 9946498 - 9946421
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
||||||| || ||||||||||| ||||||||||||| |||||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
9946498 |
gtggtggtcggggtttgaaccccggaccttgcatattttatgcattgtccataccaactgagctaagctcacgaggac |
9946421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 124 - 170
Target Start/End: Complemental strand, 53190350 - 53190304
Alignment:
| Q |
124 |
gaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
53190350 |
gaaccctggaccttgcatatattatgcattatccataccaactgagc |
53190304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 56551582 - 56551644
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
56551582 |
gtggtggccggggtttgaacctcggaccttgcatatattatgcattgtccttaccaactgagc |
56551644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 109 - 170
Target Start/End: Original strand, 16304089 - 16304150
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||| |||||||| || |||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
16304089 |
tggtggccgcggtttgaatcccggaccttgcatatattatgcattgtccataccaactgagc |
16304150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 6 - 87
Target Start/End: Original strand, 21954833 - 21954915
Alignment:
| Q |
6 |
tgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttt-tttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||| ||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
21954833 |
tgtattgaaaagtgaaattggtcaatttttttgggacaatattttttttgcaaatgactcacttattatggtacggagggagt |
21954915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 38319889 - 38319807
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||| |||||| || ||||||||||||||||||||||||| |
|
|
| T |
38319889 |
ttgtattgaaaagtgaaatgagtcaatttttcagaaacaatattttgttgcaagtggttcagttattatgggacggagggagt |
38319807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 47490697 - 47490758
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||| ||| |||| |||| ||||||||||| |
|
|
| T |
47490697 |
gtggtggccgaggtttgaacccggaaccttgcatattttacgcattatccataccaactgag |
47490758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 5 - 87
Target Start/End: Original strand, 49218912 - 49218988
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| || ||||| ||||||||||||||||| |||||||| |
|
|
| T |
49218912 |
ttgtattgaaaagtgaaatgagtcaatt------ggacaatatttttgtgaaaatggctcagttattatgggactgagggagt |
49218988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 111 - 184
Target Start/End: Original strand, 10303504 - 10303579
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||| |||||||| ||| |||||||||||| |||||||||||||| |
|
|
| T |
10303504 |
gtggccgaggttcgaaccccggatcttgcatattttatgcattgtccttaccaactgagctaagctcacgaggaca |
10303579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 119 - 167
Target Start/End: Complemental strand, 23775578 - 23775530
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactg |
167 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
23775578 |
ggttcgaaccctggaccttgcatatattatgcattgtccctaccaactg |
23775530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 25390652 - 25390612
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
25390652 |
ttttgttgcaaatgactcagttattatgggacggagggagt |
25390612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 48740457 - 48740417
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
48740457 |
tttttttgcaaatgactcagttattatgagacggagggagt |
48740417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 49041971 - 49042015
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
49041971 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcat |
49042015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 5 - 82
Target Start/End: Complemental strand, 54217320 - 54217243
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggag |
82 |
Q |
| |
|
|||||||||||| ||||||||||||| | |||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
54217320 |
ttgtattgaaaaatgaaatgagtcaatttttctagaacaatatttttttgtaaatgactcagctattatgggacggag |
54217243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 187
Target Start/End: Complemental strand, 2888945 - 2888863
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgca-tcatccctaccaactgagc--agctcacgaggacagac |
187 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||| || | |||||||||||||||| ||||||| ||||||||| |
|
|
| T |
2888945 |
gtggtggccggggtttgaaccgcggaccttgcatatattatacatttgtccctaccaactgagctaagctcacaaggacagac |
2888863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 8495058 - 8494980
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| | ||||||| | ||| |||||||||||||||||| |||||||||||||||| || ||||||||||| |
|
|
| T |
8495058 |
gtggtggccgggatttgaactcgggatcttgcatatattatgcattgtccctaccaactgagctaagttcacgaggaca |
8494980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 119 - 170
Target Start/End: Complemental strand, 20383548 - 20383497
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
20383548 |
ggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagc |
20383497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 119 - 183
Target Start/End: Complemental strand, 44816001 - 44815935
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
44816001 |
ggtttgaaccccggaccttgcatatattatgcattatcctatccaactgagcttagctcacgaggac |
44815935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 109 - 167
Target Start/End: Complemental strand, 281661 - 281603
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactg |
167 |
Q |
| |
|
||||| ||||||||||||||| ||||||| |||||||||||||| ||| ||||||||| |
|
|
| T |
281661 |
tggtgtccgaggtttgaaccccggacctttcatatattatgcattgtccataccaactg |
281603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 111 - 169
Target Start/End: Original strand, 2434451 - 2434509
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||| |||||||| || |||||||||||| |
|
|
| T |
2434451 |
gtggtcgaggtttgaacccctgaccttgcatatagtatgcatcgtctctaccaactgag |
2434509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 3936698 - 3936636
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||| |||| |||||| |||||||||||||||||||||| | | |||||||||||| |
|
|
| T |
3936698 |
gtggtggccggggttcgaaccccggaccttgcatatattatgcattgttcataccaactgagc |
3936636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 109 - 184
Target Start/End: Complemental strand, 6087817 - 6087740
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||| | ||||||||||| ||||||||||||||||||||| ||| |||||||||||| ||||||| |||||| |
|
|
| T |
6087817 |
tggtggctggggtttgaaccccagaccttgcatatattatgcattatctataccaactgagctaagctcacaaggaca |
6087740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 8027387 - 8027449
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||| || ||||||||||| || |||||||||||||||||| |||| |||||||||||| |
|
|
| T |
8027387 |
gtggtggtcggggtttgaacccccgatcttgcatatattatgcattatccttaccaactgagc |
8027449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 150
Target Start/End: Complemental strand, 11198399 - 11198357
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgc |
150 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
11198399 |
gtggtggccggggtttgaaccccggaccttgcatatattatgc |
11198357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 44 - 78
Target Start/End: Complemental strand, 18509781 - 18509747
Alignment:
| Q |
44 |
atatttttttgcaaatgactcagttattatgggac |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
18509781 |
atatttttttgcaaatgactcagttattatgggac |
18509747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 19854636 - 19854574
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||| |||||||| |||||| ||| |||||||||||||||||| ||| |||||||||||| |
|
|
| T |
19854636 |
gtggtgtccgaggttcgaaccccggatcttgcatatattatgcattgtccataccaactgagc |
19854574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 21317328 - 21317390
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
21317328 |
gtggtggttgaggtttgaacccctgaccttgcatatattatgcattgtctctaccaactgagc |
21317390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 28435238 - 28435300
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||| | ||||||||||| | |||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
28435238 |
gtggtggctggggtttgaaccccgaaccttgcatatattatgcattgtccataccaactgagc |
28435300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 29550852 - 29550911
Alignment:
| Q |
1 |
aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatg |
60 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
29550852 |
aatgttgtattgaaaagtgaaatgggtcaagattcttgggacaatatttttttgcaaatg |
29550911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 35287497 - 35287574
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||| |||| |||||| ||||||||||||| |||||||| | | |||||||||||| ||||||||||||| |
|
|
| T |
35287497 |
gtggtggccggggttggaaccccggaccttgcatattttatgcattgttcataccaactgagctaagctcacgaggac |
35287574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 166
Target Start/End: Complemental strand, 38375028 - 38374970
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaact |
166 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||||||||||||||| |||||||||||| |
|
|
| T |
38375028 |
gtggtggccggggtttgaactccagaccttgcatatattatgcattgtccctaccaact |
38374970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 43034332 - 43034409
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggac |
183 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||| ||| ||||||||||| ||||||||||||| |
|
|
| T |
43034332 |
gtggtggccggggtttgaacctcagaccttgcatatattatgcattgtccataccaactgagttaagctcacgaggac |
43034409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 132 - 170
Target Start/End: Original strand, 50442761 - 50442799
Alignment:
| Q |
132 |
gaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
50442761 |
gaccttgcatatattatgcattatccctaccaactgagc |
50442799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 111 - 169
Target Start/End: Complemental strand, 56205014 - 56204957
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
56205014 |
gtggccgaggtttgaatcc-ggaccttgcatatattatgcattgtccttaccaactgag |
56204957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 111 - 152
Target Start/End: Complemental strand, 10148247 - 10148206
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
10148247 |
gtggccgaggtttgaactctgaaccttgcatatattatgcat |
10148206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 120 - 169
Target Start/End: Original strand, 17423179 - 17423228
Alignment:
| Q |
120 |
gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| || |||||||||||| |
|
|
| T |
17423179 |
gtttgaaccccggaccttgcatatattatgcattgtctctaccaactgag |
17423228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 119 - 152
Target Start/End: Complemental strand, 18094465 - 18094432
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
18094465 |
ggtttgaaccctggaccttgcatatattatgcat |
18094432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 132 - 169
Target Start/End: Original strand, 20096284 - 20096321
Alignment:
| Q |
132 |
gaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
20096284 |
gaccttgcatatattatgcattatccctaccaactgag |
20096321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 120 - 165
Target Start/End: Original strand, 25783451 - 25783496
Alignment:
| Q |
120 |
gtttgaaccctggaccttgcatatattatgcatcatccctaccaac |
165 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
25783451 |
gtttgaaccccggaccttgcatatattatgcattgtccctaccaac |
25783496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 116 - 169
Target Start/End: Complemental strand, 29908119 - 29908066
Alignment:
| Q |
116 |
cgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
29908119 |
cgaggtttgaactccggaccttgcatatattatgcattgtccttaccaactgag |
29908066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 109 - 170
Target Start/End: Complemental strand, 32006570 - 32006509
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||| |||||||||| | || || |||||||||||||| ||||||||||||||||| |
|
|
| T |
32006570 |
tggtggccggagtttgaaccccgaactttacatatattatgcattatccctaccaactgagc |
32006509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 42024326 - 42024412
Alignment:
| Q |
1 |
aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||| |||||||||||||||||||| ||| ||||| | |||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42024326 |
aatgatgtattgaaaagtgaaatgactcatttatcttaggacacttttttattgaaaatgactcagttattatgggacggagggagt |
42024412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 38 - 87
Target Start/End: Complemental strand, 42132758 - 42132709
Alignment:
| Q |
38 |
gggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| || | ||||||| |
|
|
| T |
42132758 |
gggacaataattttttgcaaatgactcagttattatgagatgtagggagt |
42132709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 42 - 87
Target Start/End: Complemental strand, 46958662 - 46958617
Alignment:
| Q |
42 |
caatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||| |||||||| || ||||||||||||||||||||||| |
|
|
| T |
46958662 |
caatatttttatgcaaatggcttagttattatgggacggagggagt |
46958617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 9093904 - 9093944
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
9093904 |
tttttttacaaatgactcagttattatgggacggaaggagt |
9093944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 117 - 169
Target Start/End: Original strand, 14197430 - 14197482
Alignment:
| Q |
117 |
gaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||||||||| ||| ||| |||||||||||||| ||||||||||||||| |
|
|
| T |
14197430 |
gaggtttgaaccccggatcttacatatattatgcattgtccctaccaactgag |
14197482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 21449889 - 21449932
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
21449889 |
gtggtggccg-ggtttgaaccctggaccttgcatatatcatgcat |
21449932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 112 - 168
Target Start/End: Original strand, 21623413 - 21623469
Alignment:
| Q |
112 |
tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga |
168 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21623413 |
tggccgaggtttaaacctcagaccttgcatatattatgcattgtccctaccaactga |
21623469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 34042311 - 34042267
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||| |||||||||||||| | |||||||||||||||||||| |
|
|
| T |
34042311 |
gtggtggtcgaggtttgaaccccgaaccttgcatatattatgcat |
34042267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 39053073 - 39053113
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
39053073 |
tttttttgtaaatgactcagttattatggaacggagggagt |
39053113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 39258447 - 39258487
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
39258447 |
tttttttacaaatgactcagttattatgggatggagggagt |
39258487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 41594875 - 41594915
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
41594875 |
tttttttgcaaatggctcacttattatgggacggagggagt |
41594915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 42670552 - 42670592
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
42670552 |
tttttttgcaaatgactcagttattatgagacggagcgagt |
42670592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 111 - 184
Target Start/End: Original strand, 47814244 - 47814319
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||| | ||| |||||||||||| |||| ||||||||| |
|
|
| T |
47814244 |
gtggccggggtttgaaccccggaccttgcatatattatgtgttgtccataccaactgagctaagcttacgaggaca |
47814319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 119 - 184
Target Start/End: Complemental strand, 49473705 - 49473638
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||| ||| ||||||||| || |||||||||||||| |
|
|
| T |
49473705 |
ggttcgaaccccggaccttgcatatattatgcattgtccttaccaactgggctaagctcacgaggaca |
49473638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 54294412 - 54294456
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||| ||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
54294412 |
gtggtgtccggggtttgaaccccggaccttgcatatattatgcat |
54294456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 54857605 - 54857649
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||| |||||||| |
|
|
| T |
54857605 |
gtggtggccggggtttgaaccccggaccttgcatattttatgcat |
54857649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 119 - 170
Target Start/End: Complemental strand, 675978 - 675927
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
675978 |
ggtttgaaccccggaccttgcatatattatgcattgtccaaaccaactgagc |
675927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 132 - 184
Target Start/End: Original strand, 2186347 - 2186401
Alignment:
| Q |
132 |
gaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||| |||||||||||||| |
|
|
| T |
2186347 |
gaccttgcatatattatgcattgtccataccaactgagctaagctcacgaggaca |
2186401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 131 - 170
Target Start/End: Original strand, 2649746 - 2649785
Alignment:
| Q |
131 |
ggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2649746 |
ggaccttgcatatattatgcattgtccctaccaactgagc |
2649785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 16470375 - 16470297
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||| || |||| |||||||||||||||||||| |||||||| ||| |||||| ||||| ||||||||||||| |
|
|
| T |
16470375 |
gtggtggtcggggttcgaaccctggaccttgcatattttatgcattgtccataccaattgagctacgctcacgaggaca |
16470297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 17728153 - 17728075
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| |||||||| || |||| ||||||||||||||| |||| |||||||||||| ||||||||||||| |
|
|
| T |
17728153 |
gtggtggccggaatttgaaccatgaacctagcatatattatgcattatccataccaactgagctatgctcacgaggaca |
17728075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 109 - 152
Target Start/End: Original strand, 19479468 - 19479511
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||| || ||||||||||| |||||||||||||||||||||| |
|
|
| T |
19479468 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcat |
19479511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 143
Target Start/End: Original strand, 29240213 - 29240248
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatat |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29240213 |
gtggtggccgaggtttgaaccctggaccttacatat |
29240248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 73
Target Start/End: Original strand, 35029226 - 35029294
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattat |
73 |
Q |
| |
|
||||||||||||||||||||| |||| || |||||||||||||||||||||||| ||||||| |
|
|
| T |
35029226 |
ttgtattgaaaagtgaaatgaatcaattttgttggaacaatatttttttgcaaatgactcgcttattat |
35029294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 120 - 184
Target Start/End: Complemental strand, 36035893 - 36035827
Alignment:
| Q |
120 |
gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||| |||| || |||||||| |||||||||||||| |
|
|
| T |
36035893 |
gtttgaaccccggaccttggatatattatgcattatccaaactaactgagctaagctcacgaggaca |
36035827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 119 - 183
Target Start/End: Original strand, 39171371 - 39171437
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||| ||| || ||||||||| ||||||||||||| |
|
|
| T |
39171371 |
ggtttgaaccctgaaccttgcatattttatgcattgtccatatcaactgagctaagctcacgaggac |
39171437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 132 - 184
Target Start/End: Original strand, 52270044 - 52270098
Alignment:
| Q |
132 |
gaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||| |||||||||||||| |
|
|
| T |
52270044 |
gaccttgcatatattatgcattgtccataccaactgagctaagctcacgaggaca |
52270098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 120 - 180
Target Start/End: Complemental strand, 54500628 - 54500566
Alignment:
| Q |
120 |
gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgag |
180 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||| || ||||||||||||| |||||||||| |
|
|
| T |
54500628 |
gtttgaaccccggaccttacatatattatgcattgtctctaccaactgagctaagctcacgag |
54500566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 87
Target Start/End: Original strand, 283650 - 283688
Alignment:
| Q |
49 |
tttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
283650 |
tttttgcaaatgacttagttattatgggacggagtgagt |
283688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 120 - 170
Target Start/End: Original strand, 836237 - 836287
Alignment:
| Q |
120 |
gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||| |||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
836237 |
gtttgaacctcggaccttgcatatattttgcattgtccctaccaactgagc |
836287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 2034085 - 2034147
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||| ||||| ||||||||| |||||| ||||||||||||| |||| |||||||||||| |
|
|
| T |
2034085 |
gtggtgtccgagatttgaaccccagaccttaaatatattatgcattatccataccaactgagc |
2034147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 2587691 - 2587752
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||| | ||||||||||| ||||||| |||||||||||||| |||| |||||| ||||| |
|
|
| T |
2587691 |
gtggtggctggggtttgaaccc-ggaccttacatatattatgcattatccataccaattgagc |
2587752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 5924720 - 5924658
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||| |||||||||||||| ||||||| ||||||||||| || ||| || ||||||||| |
|
|
| T |
5924720 |
gtggtggtcgaggtttgaaccccggaccttccatatattatgtattgtccatagcaactgagc |
5924658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 10261759 - 10261835
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||||||| |||||||| | |||||||||| ||| ||||||||||||| |
|
|
| T |
10261759 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac |
10261835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 132 - 183
Target Start/End: Complemental strand, 13121591 - 13121538
Alignment:
| Q |
132 |
gaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||| ||||||||||||| |
|
|
| T |
13121591 |
gaccttgcatatattatgcattgtccctaccaactaagctaagctcacgaggac |
13121538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 112 - 170
Target Start/End: Original strand, 14577501 - 14577559
Alignment:
| Q |
112 |
tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||| ||||||||| | |||| ||||||||||||||||| ||| |||||||||||| |
|
|
| T |
14577501 |
tggccggggtttgaactccggactttgcatatattatgcattgtccttaccaactgagc |
14577559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 16431687 - 16431625
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||| ||||| ||||||||||| |||||||||||| |||||||| ||| |||||||||||| |
|
|
| T |
16431687 |
gtggaggccggggtttgaaccccagaccttgcatattttatgcattgtccataccaactgagc |
16431625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 21562696 - 21562620
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||||||| |||||||| | |||||||||| ||| ||||||||||||| |
|
|
| T |
21562696 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac |
21562620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 120 - 170
Target Start/End: Complemental strand, 23160099 - 23160049
Alignment:
| Q |
120 |
gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||| ||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
23160099 |
gtttgaacctcggaccttacatatattatgcattgtccctaccaactgagc |
23160049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 23247588 - 23247665
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||| ||||| ||||| ||||||||||||||||||| | ||| ||||||| |||| ||||||||||||| |
|
|
| T |
23247588 |
gtggtggccggggtttaaaccccagaccttgcatatattatgcgttgtccataccaaccgagctaagctcacgaggac |
23247665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 169
Target Start/End: Complemental strand, 25115109 - 25115059
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
25115109 |
ggtttgaaccctgaaccttgcatatgttatgcattgtccataccaactgag |
25115059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 26926700 - 26926776
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||||||| |||||||| | |||||||||| ||| ||||||||||||| |
|
|
| T |
26926700 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac |
26926776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 28279819 - 28279760
Alignment:
| Q |
1 |
aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatg |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| || |||||| |
|
|
| T |
28279819 |
aatgttgtattgaaaagtgaaatgagtcaagattcttgggacaatattttgttacaaatg |
28279760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 128 - 170
Target Start/End: Complemental strand, 34247491 - 34247449
Alignment:
| Q |
128 |
cctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
34247491 |
cctggaccttgcatatattatgcattgtccttaccaactgagc |
34247449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 41 - 87
Target Start/End: Original strand, 37316087 - 37316133
Alignment:
| Q |
41 |
acaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||| |||||||||||| |
|
|
| T |
37316087 |
acaatatttttttgaaaatgactcaattattataagacggagggagt |
37316133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 37921817 - 37921755
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||| |||| |||||||| || |||||||||||||||||||||| ||| ||| |||||||| |
|
|
| T |
37921817 |
gtggtagccggggtttgaatcccggaccttgcatatattatgcattgtccttactaactgagc |
37921755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 87
Target Start/End: Original strand, 39976564 - 39976602
Alignment:
| Q |
49 |
tttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
39976564 |
tttttgcaaatgactcagttattatgagacggagtgagt |
39976602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 47 - 77
Target Start/End: Complemental strand, 41203640 - 41203610
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatggga |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41203640 |
tttttttgcaaatgactcagttattatggga |
41203610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 43330217 - 43330141
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||||||| |||||||| | |||||||||| ||| ||||||||||||| |
|
|
| T |
43330217 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac |
43330141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 169
Target Start/End: Complemental strand, 43722825 - 43722775
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
43722825 |
ggtttgaaccccggaccttacatatattatgcattgtccataccaactgag |
43722775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 124 - 170
Target Start/End: Original strand, 46676504 - 46676550
Alignment:
| Q |
124 |
gaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
46676504 |
gaaccccggaccttgcatatattatgcattgtccttaccaactgagc |
46676550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 51450283 - 51450207
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||||||| |||||||| | |||||||||| ||| ||||||||||||| |
|
|
| T |
51450283 |
gtggtggccggggtttgaactccggaccttgcatatcttatgcattgt-cctaccaactaagctaagctcacgaggac |
51450207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 38 - 87
Target Start/End: Complemental strand, 8759725 - 8759676
Alignment:
| Q |
38 |
gggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
8759725 |
gggacagtatttttttgcaaatggctccattattatgggacggaaggagt |
8759676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 149
Target Start/End: Complemental strand, 8760307 - 8760266
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatg |
149 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||| ||||| |
|
|
| T |
8760307 |
gtggtggccgaggtttgaactctggatcttgcatattttatg |
8760266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 149
Target Start/End: Complemental strand, 10035336 - 10035295
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatg |
149 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
10035336 |
gtggtggccggggtttgaaccccagaccttgcatatattatg |
10035295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 19908763 - 19908702
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||| || |||| ||||| |||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
19908763 |
gtggtggtcggggttcgaacctcggaccttgcatatattatgcattgtccttaccaactgag |
19908702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 111 - 148
Target Start/End: Original strand, 20566735 - 20566771
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatattat |
148 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
20566735 |
gtggccgaggtttgaaccc-ggaccttgcatatattat |
20566771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 165
Target Start/End: Original strand, 21114295 - 21114352
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaac |
165 |
Q |
| |
|
||||||| || ||||||||||| ||||||||||||||| |||||| ||| ||||||| |
|
|
| T |
21114295 |
gtggtggtcggggtttgaaccccggaccttgcatatatcatgcattgtccataccaac |
21114352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 119 - 152
Target Start/End: Original strand, 30850385 - 30850418
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
30850385 |
ggtttgaaccctgaaccttgcatatattatgcat |
30850418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 5 - 79
Target Start/End: Complemental strand, 34021013 - 34020939
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacg |
79 |
Q |
| |
|
||||||||||||||||||||| ||| | |||| | |||||||||||||||||| |||||||||||||| |
|
|
| T |
34021013 |
ttgtattgaaaagtgaaatgactcacttattttgagacattttttttttgcaaatgactcggttattatgggacg |
34020939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 131 - 185
Target Start/End: Complemental strand, 36203284 - 36203228
Alignment:
| Q |
131 |
ggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacag |
185 |
Q |
| |
|
|||||||||||||||||||||| ||| || ||||||||| ||||||||||||||| |
|
|
| T |
36203284 |
ggaccttgcatatattatgcattgtccttatcaactgagctaagctcacgaggacag |
36203228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 120 - 182
Target Start/End: Complemental strand, 37193308 - 37193244
Alignment:
| Q |
120 |
gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgagga |
182 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||| ||| ||| |||||||| |||||||||||| |
|
|
| T |
37193308 |
gtttgaaccccggaccttgcatatattatacattgtccatactaactgagctaagctcacgagga |
37193244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 133 - 170
Target Start/End: Complemental strand, 38416103 - 38416066
Alignment:
| Q |
133 |
accttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
38416103 |
accttgcatatattatgcattatccttaccaactgagc |
38416066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 120 - 169
Target Start/End: Complemental strand, 41521013 - 41520964
Alignment:
| Q |
120 |
gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||||| || |||||||||||||||||||| || |||||||||||| |
|
|
| T |
41521013 |
gtttgaaccttgaaccttgcatatattatgcattgtctctaccaactgag |
41520964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 109 - 170
Target Start/End: Original strand, 43782296 - 43782357
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||| || |||||||||||| |
|
|
| T |
43782296 |
tggtggtcgaggtttgaaccgcagaccttgcatatattatgcattgtcattaccaactgagc |
43782357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 44909895 - 44909834
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||| ||||||||||||||| || ||||||||| ||||||| || ||||||||||| |
|
|
| T |
44909895 |
gtggtggctgaggtttgaaccctgaactttgcatatactatgcattgtctttaccaactgag |
44909834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 115 - 152
Target Start/End: Original strand, 49953400 - 49953437
Alignment:
| Q |
115 |
ccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
49953400 |
ccgaagtttgaaccccggaccttgcatatattatgcat |
49953437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 1825421 - 1825461
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
1825421 |
ttttgttgcaaatgactcagttgttatgggacggagagagt |
1825461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 6586211 - 6586136
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagcagctcacgaggaca |
184 |
Q |
| |
|
||||||| ||||||||||||| | ||||| |||||| ||||||| | |||||||||||| |||||||||||||| |
|
|
| T |
6586211 |
gtggtggatgaggtttgaaccc-gaaccttccatatactatgcattgttcctaccaactgataagctcacgaggaca |
6586136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 8294961 - 8294921
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||| |||| |||||||||||| |||||||| |
|
|
| T |
8294961 |
tttttttgcaaatggctcaattattatgggacagagggagt |
8294921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 9196284 - 9196240
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||| |||||| |||||||||||| ||||||||||||||| |
|
|
| T |
9196284 |
gtggtggctgaggttcaaaccctggacctggcatatattatgcat |
9196240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 9783970 - 9783926
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
9783970 |
gtggtggccgaggtttgaacctcagaccttacatatattatgcat |
9783926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 170
Target Start/End: Original strand, 13264272 - 13264332
Alignment:
| Q |
110 |
ggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||| ||| |||| |||||| || ||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
13264272 |
ggtgtccggggttcgaaccccggtccttgcatataatatgcaatatccctaccaactgagc |
13264332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 131 - 184
Target Start/End: Complemental strand, 13276177 - 13276122
Alignment:
| Q |
131 |
ggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggaca |
184 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||| |||||||||||||| |
|
|
| T |
13276177 |
ggaccttgcatatattatgcattgtccctaccaattgagttaagctcacgaggaca |
13276122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 13529798 - 13529758
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||| ||||| |
|
|
| T |
13529798 |
tttttttgcaaatgactcagttgttataggacggatggagt |
13529758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 184
Target Start/End: Original strand, 14202480 - 14202547
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggaca |
184 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||| |||| | |||||||| |||||||||||||| |
|
|
| T |
14202480 |
ggtttgaaccccggaccttacatatattatgcattatccaaatcaactgagttaagctcacgaggaca |
14202547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 109 - 169
Target Start/End: Original strand, 22630351 - 22630411
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||| || |||||||||| ||||||||||||||||||||| || |||||||||||| |
|
|
| T |
22630351 |
tggtggtcggggtttgaacctcagaccttgcatatattatgcattgtcactaccaactgag |
22630411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 39 - 75
Target Start/End: Original strand, 33093613 - 33093649
Alignment:
| Q |
39 |
ggacaatatttttttgcaaatgactcagttattatgg |
75 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
33093613 |
ggacaatatttttttgcaaatgacttacttattatgg |
33093649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 35998289 - 35998329
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||| ||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
35998289 |
ttttgttgaaaatgactccgttattatgggacggagggagt |
35998329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 39974573 - 39974529
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||| ||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
39974573 |
gtggtgtccgaggtttgaaccccagaccttccatatattatgcat |
39974529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 39 - 87
Target Start/End: Complemental strand, 41436425 - 41436377
Alignment:
| Q |
39 |
ggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||| | |||| |||||||||||||||||||||||||| |
|
|
| T |
41436425 |
ggacaatatttttctacaaaaagctcagttattatgggacggagggagt |
41436377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 42051829 - 42051869
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||| |||||| ||||||||||| |||||||||||||| |
|
|
| T |
42051829 |
tttttttacaaatggctcagttattacgggacggagggagt |
42051869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 43420961 - 43420921
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||| || ||||||||| ||||||||||||||| |
|
|
| T |
43420961 |
tttttttgcaaaagaatcagttattgtgggacggagggagt |
43420921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 151
Target Start/End: Original strand, 48694651 - 48694683
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgca |
151 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
48694651 |
ggtttgaactctggaccttgcatatattatgca |
48694683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 49385296 - 49385340
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||||||||||||||| | ||| ||| |||||||||||||| |
|
|
| T |
49385296 |
gtggtggccgaggtttgaactccggatcttacatatattatgcat |
49385340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 113 - 153
Target Start/End: Original strand, 50152233 - 50152273
Alignment:
| Q |
113 |
ggccgaggtttgaaccctggaccttgcatatattatgcatc |
153 |
Q |
| |
|
||||| ||||||||||| | ||||||||||||||||||||| |
|
|
| T |
50152233 |
ggccggggtttgaaccccgaaccttgcatatattatgcatc |
50152273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 58; Significance: 2e-24; HSPs: 106)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 14689938 - 14689856
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14689938 |
ttgtattgaaaagtgaaatgggtcaatttttctgggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
14689856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 3 - 87
Target Start/End: Complemental strand, 2195448 - 2195364
Alignment:
| Q |
3 |
tgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2195448 |
tgttgtattgaaaagtgaaatgggtcaatttttttgggacaacatttttttgcaaatgactcagttattatgggacggagagagt |
2195364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 2797017 - 2796935
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
2797017 |
ttgtattgaaaagtgaaatgagtcaagtttttttgaacaatatttttttgcaaatggctcacttattatgggacggagggagt |
2796935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 108 - 164
Target Start/End: Complemental strand, 8881346 - 8881290
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaa |
164 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8881346 |
gtggtggccggggtttgaaccctggaccttgcatatattatgcattgtccctaccaa |
8881290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 27587292 - 27587215
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||| |||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
27587292 |
gtggtggccggggtttgaaccccggaccttgcatatatcatgcattgtccttaccaactgagctaagctcacgaggac |
27587215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 5 - 87
Target Start/End: Original strand, 8394647 - 8394729
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||| |||||||||||||||||||| | |||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
8394647 |
ttgtactgaaaagtgaaatgagtcaatttttctagaacaatatttttttgtaaatgactcagttactatgggacggagggagt |
8394729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 109 - 170
Target Start/End: Original strand, 8717466 - 8717527
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
8717466 |
tggtggccgaggtttgaaccccgaaccttgcatatattatgcattgtccataccaactgagc |
8717527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 38 - 87
Target Start/End: Original strand, 10729083 - 10729131
Alignment:
| Q |
38 |
gggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10729083 |
gggacaatatttt-ttgcaaatgactcagttattatgggacggagggagt |
10729131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 38 - 87
Target Start/End: Original strand, 38252600 - 38252649
Alignment:
| Q |
38 |
gggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38252600 |
gggacactttttttttgcaaatgactcagttattatgggacggagggagt |
38252649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 119 - 185
Target Start/End: Complemental strand, 39821944 - 39821876
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacag |
185 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
39821944 |
ggtttgaaccccagaccttgcatatattatgcattgtccctaccaactgagctaagctcacgaggacag |
39821876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 167
Target Start/End: Complemental strand, 12748972 - 12748913
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactg |
167 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
12748972 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccataccaactg |
12748913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 6235541 - 6235603
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||| |||||||| || ||||||| ||||||||||||||| ||| |||||||||||| |
|
|
| T |
6235541 |
gtggtggccggggtttgaatcccggaccttacatatattatgcatcgtccataccaactgagc |
6235603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 13357431 - 13357508
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggac |
183 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||| ||| ||||||||||| ||||||||||||| |
|
|
| T |
13357431 |
gtggtggccgaggtttgaacctcgtaccttgcatatattatgcattgtccataccaactgagttaagctcacgaggac |
13357508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 19163526 - 19163603
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
||||||| || ||||||||||| |||||||||||| ||||||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
19163526 |
gtggtggtcggggtttgaaccccggaccttgcataaattatgcattgtccataccaactgagctaagctcacgaggac |
19163603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 41 - 87
Target Start/End: Complemental strand, 29451290 - 29451244
Alignment:
| Q |
41 |
acaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
29451290 |
acaatatttttttgcaaatgattcagttattatgggacggatggagt |
29451244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 32051522 - 32051584
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
32051522 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccaaaccaactgagc |
32051584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 125 - 184
Target Start/End: Original strand, 33451356 - 33451417
Alignment:
| Q |
125 |
aaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||| |||||||||||| |||||||||||||| |
|
|
| T |
33451356 |
aacccttgaccttgcatatattatgcattatccataccaactgagctaagctcacgaggaca |
33451417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 120 - 169
Target Start/End: Complemental strand, 7553738 - 7553689
Alignment:
| Q |
120 |
gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7553738 |
gtttgaaccttggaccttgcatatattatgcattgtccctaccaactgag |
7553689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 109 - 183
Target Start/End: Complemental strand, 11709056 - 11708980
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||| || ||||||||| |||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
11709056 |
tggtggtcggggtttgaacttcggaccttgcatatattatgcattgtccctaccaactgagctaagctcacgaggac |
11708980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 108 - 182
Target Start/End: Complemental strand, 17704084 - 17704008
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgagga |
182 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||| ||| |||||||||||| |||||||||||| |
|
|
| T |
17704084 |
gtggtggccgaggtttgaatcacagaccttgcatatattatgcattgtccttaccaactgagctaagctcacgagga |
17704008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 5 - 87
Target Start/End: Original strand, 45421069 - 45421151
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||| || || ||||||||||||||||| ||||| ||||||| |||||| ||||||||||| |
|
|
| T |
45421069 |
ttgtattgaaaagtgaaatgggttaatttatctgggacaatatttttttgtaaatggctcagttgttatggaacggagggagt |
45421151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 8999881 - 8999960
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgca-tcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||| || |||||||||||||||| |||||||||||||||| | || ||||||||||||| |||||||||||||| |
|
|
| T |
8999881 |
gtggtggtcggggtttgaaccctggactttgcatatattatgcatttgtctctaccaactgagctaagctcacgaggaca |
8999960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 109 - 169
Target Start/End: Original strand, 13449788 - 13449848
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||||||||||||| | || ||||||||||||||||| ||||||||||||||| |
|
|
| T |
13449788 |
tggtggccgaggtttgaacctcgaactttgcatatattatgcatggtccctaccaactgag |
13449848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 39 - 87
Target Start/End: Complemental strand, 15020617 - 15020569
Alignment:
| Q |
39 |
ggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| ||| ||||| |
|
|
| T |
15020617 |
ggacaatatttttttgcaaatgactcacttattatgggatggatggagt |
15020569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 32967448 - 32967488
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32967448 |
tttttttgcaaatgactcagttattatgggacggatggagt |
32967488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 84
Target Start/End: Original strand, 8566535 - 8566615
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttt-tttgcaaatgactcagttattatgggacggaggg |
84 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||| ||||||||||||| ||||||||||| |||||||| |
|
|
| T |
8566535 |
ttgtattgaaaagtgaaatgggtcaatttttctaggacaatattttttttgcaaatgactaagttattatggtacggaggg |
8566615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 13575360 - 13575282
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||||||||||| ||||| ||| ||||||||| |||||||| |||||||||||||||| | |||||||||||| |
|
|
| T |
13575360 |
gtggtggccgaggttcgaacctcggaacttgcatatgttatgcattgtccctaccaactgagctaaactcacgaggaca |
13575282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 14117444 - 14117384
Alignment:
| Q |
1 |
aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatga |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
14117444 |
aatgttgtattgaaaagtgaaatgagtcaagattcttgggacaatatttttttacaaatga |
14117384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 119 - 170
Target Start/End: Complemental strand, 18942978 - 18942927
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||| || ||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
18942978 |
ggtttgaaacccggaccatgcatatattatgcattatccctaccaactgagc |
18942927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 116 - 184
Target Start/End: Original strand, 27750902 - 27750972
Alignment:
| Q |
116 |
cgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||| ||| |||||||||||| |||||||||||||| |
|
|
| T |
27750902 |
cgaggttcgaaccccggaccttgcatatattatgcactgtccttaccaactgagctaagctcacgaggaca |
27750972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 109 - 152
Target Start/End: Complemental strand, 29652288 - 29652245
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29652288 |
tggtggtcgaggtttgaactctggaccttgcatatattatgcat |
29652245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 37999409 - 37999487
Alignment:
| Q |
108 |
gtggtggccgaggttt-gaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggac |
183 |
Q |
| |
|
|||||||||| ||||| ||||||| |||||||||||||||||||| |||| ||||||||||| ||||||||||||| |
|
|
| T |
37999409 |
gtggtggccggggtttagaaccctataccttgcatatattatgcattatccataccaactgagttaagctcacgaggac |
37999487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 115 - 170
Target Start/End: Original strand, 42208466 - 42208521
Alignment:
| Q |
115 |
ccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
42208466 |
ccgaggtttgaacctcggaccttgcatatattatgcattgtccttaccaactgagc |
42208521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 109 - 152
Target Start/End: Original strand, 44084263 - 44084305
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44084263 |
tggtggccgaggtttgaaccc-ggaccttgcatatattatgcat |
44084305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 444484 - 444422
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||| ||||| ||||| |||||||||||||||||||||| ||| |||||| ||||| |
|
|
| T |
444484 |
gtggtggccggggtttaaaccccggaccttgcatatattatgcattgtccttaccaattgagc |
444422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 41 - 87
Target Start/End: Original strand, 2875251 - 2875297
Alignment:
| Q |
41 |
acaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
2875251 |
acaatatttttttgcaaatggctcgcttattatgggacggagggagt |
2875297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 5179864 - 5179802
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||||| |||||||||| | |||||| ||||||||||||| ||| |||||||||||| |
|
|
| T |
5179864 |
gtggtggccgaagtttgaaccccgaaccttgtatatattatgcattgtccttaccaactgagc |
5179802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 112 - 166
Target Start/End: Original strand, 10871888 - 10871942
Alignment:
| Q |
112 |
tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaact |
166 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||| ||| |||||||| |
|
|
| T |
10871888 |
tggccgaggtttgaaccccggaccttgcatacattatgcattgtccataccaact |
10871942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 24838160 - 24838222
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
24838160 |
gtggtggccggggtttgaaccccggaccttgcatattttatgcattgtcctaaccaactgagc |
24838222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 25136834 - 25136896
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||| | ||| |||||||||||| |
|
|
| T |
25136834 |
gtggtggccgaggtttgaacctcggaccttgcatattttatgccttgtccataccaactgagc |
25136896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 110 - 152
Target Start/End: Complemental strand, 44794962 - 44794920
Alignment:
| Q |
110 |
ggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
44794962 |
ggtggccgaggtttgaactccggaccttgcatatattatgcat |
44794920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 6447260 - 6447199
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||| ||| ||||||| | |||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
6447260 |
gtggtggctgagatttgaactccggaccttgcatatattatgcattgtccataccaactgag |
6447199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 110 - 184
Target Start/End: Complemental strand, 13286199 - 13286124
Alignment:
| Q |
110 |
ggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||| ||||||||||| ||| |||||||||||||||||| || |||||||||||| |||||||||||||| |
|
|
| T |
13286199 |
ggtggccggggtttgaaccc-ggatcttgcatatattatgcattgtctataccaactgagctaagctcacgaggaca |
13286124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 129 - 170
Target Start/End: Complemental strand, 29908061 - 29908020
Alignment:
| Q |
129 |
ctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29908061 |
ctggaccttgcatatattatgcattgtccctaccaactgagc |
29908020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 117 - 170
Target Start/End: Complemental strand, 30427792 - 30427740
Alignment:
| Q |
117 |
gaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
30427792 |
gaggtttgaacc-tggaccttgcatatattatgcattgtccataccaactgagc |
30427740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 119 - 168
Target Start/End: Original strand, 31336808 - 31336857
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga |
168 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| | |||||||||||| |
|
|
| T |
31336808 |
ggtttgaaccctagaccttgcatatattatgcattgttcctaccaactga |
31336857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 87
Target Start/End: Original strand, 32231849 - 32231930
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| ||||||||||| ||||||| | ||||||||| |
|
|
| T |
32231849 |
ttgtattgaaaagtgaaatgagtcaatttttttgggacaatatttttttataaatgactcag-aattatggaatggagggagt |
32231930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 38 - 87
Target Start/End: Complemental strand, 37459295 - 37459246
Alignment:
| Q |
38 |
gggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||||||||| ||||| |
|
|
| T |
37459295 |
gggacaatatttttttgcaaatgactcaatttgtatgggacggatggagt |
37459246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 121 - 169
Target Start/End: Original strand, 989580 - 989628
Alignment:
| Q |
121 |
tttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||| ||| |||||||||||| |||| |||||||||||||||| |
|
|
| T |
989580 |
tttgaaccctagacattgcatatattaggcattatccctaccaactgag |
989628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 39 - 87
Target Start/End: Original strand, 1494409 - 1494457
Alignment:
| Q |
39 |
ggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||| ||||||||||||| |
|
|
| T |
1494409 |
ggacaatatttttttgcaaaaggctcagttattacaggacggagggagt |
1494457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 168
Target Start/End: Original strand, 12800890 - 12800950
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga |
168 |
Q |
| |
|
||||||| || ||||||||||| ||||||||||||||||||| || ||| |||||||||| |
|
|
| T |
12800890 |
gtggtggtcggggtttgaaccccggaccttgcatatattatgtattgtccataccaactga |
12800950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 117 - 169
Target Start/End: Complemental strand, 13105156 - 13105104
Alignment:
| Q |
117 |
gaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||| |||||| || ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13105156 |
gaggttcgaaccccggcccttgcatatattatgcattgtccctaccaactgag |
13105104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 15001265 - 15001309
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||| |||||||| |
|
|
| T |
15001265 |
gtggtggccggggtttgaaccttggaccttgcatattttatgcat |
15001309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 19260569 - 19260613
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||||| ||||||||||| ||||||| |||||||||||||| |
|
|
| T |
19260569 |
gtggtggccggggtttgaaccccggaccttacatatattatgcat |
19260613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 135 - 184
Target Start/End: Complemental strand, 23816834 - 23816783
Alignment:
| Q |
135 |
cttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||| |||||||||||||| |
|
|
| T |
23816834 |
cttgcatatattatgcattatccttaccaactgagctaagctcacgaggaca |
23816783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 26932753 - 26932797
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||| |||||| |
|
|
| T |
26932753 |
gtggtggtcgtggtttgaaccctggaccttgcatatatcatgcat |
26932797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 119 - 184
Target Start/End: Complemental strand, 29499831 - 29499764
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||| ||| |||||| ||||| |||||||||||||| |
|
|
| T |
29499831 |
ggttcgaaccctggaccttgcatattttatgcattgtccataccaattgagctaagctcacgaggaca |
29499764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 83
Target Start/End: Complemental strand, 29615731 - 29615695
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagg |
83 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29615731 |
tttttttgcaaatgactcatttattatgggacggagg |
29615695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 30176409 - 30176453
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||| ||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
30176409 |
gtggtgtccggggtttgaaccccggaccttgcatatattatgcat |
30176453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 36122594 - 36122550
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||| ||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
36122594 |
gtggtggacgaggttcgaaccctagaccttgcatatattatgcat |
36122550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 168
Target Start/End: Complemental strand, 37141428 - 37141368
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga |
168 |
Q |
| |
|
|||||||||| |||||||||| | |||||||||||||||||||| ||| |||||||||| |
|
|
| T |
37141428 |
gtggtggccggagtttgaaccccgaaccttgcatatattatgcattgtccataccaactga |
37141368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 148
Target Start/End: Original strand, 40679719 - 40679759
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattat |
148 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
40679719 |
gtggtggccgaggtttgaaccccggaccttgcatattttat |
40679759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 44790593 - 44790633
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44790593 |
tttttttgcaaatagctcagttattatgggacggagggagt |
44790633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 7997011 - 7996933
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||| || ||||||||||| ||||||||||||||||||| | ||| |||||||||||| ||||||| |||||| |
|
|
| T |
7997011 |
gtggtggtcggggtttgaaccccagaccttgcatatattatgcgttgtccataccaactgagctaagctcacaaggaca |
7996933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 73
Target Start/End: Original strand, 17790226 - 17790294
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattat |
73 |
Q |
| |
|
||||||||||||||||||| ||| || ||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
17790226 |
ttgtattgaaaagtgaaataagtaaatttttctgggacaatatttttttgcaaatggctcaattattat |
17790294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 124 - 184
Target Start/End: Complemental strand, 19778120 - 19778058
Alignment:
| Q |
124 |
gaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||| |||||||||||| |||||||| ||||| |
|
|
| T |
19778120 |
gaaccccggaccttgcatatattatgcattgtccttaccaactgagctaagctcacggggaca |
19778058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 53 - 87
Target Start/End: Complemental strand, 12653615 - 12653581
Alignment:
| Q |
53 |
tgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
12653615 |
tgcaaatgactcagttattatgggacggagagagt |
12653581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 41 - 87
Target Start/End: Original strand, 14748872 - 14748918
Alignment:
| Q |
41 |
acaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| || ||||||||||| |
|
|
| T |
14748872 |
acaatatttttttgcaaatggctcggttattacggaacggagggagt |
14748918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 20665353 - 20665429
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||||||| |||||||| | |||||||||| ||| ||||||||||||| |
|
|
| T |
20665353 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac |
20665429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 22775699 - 22775622
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||| ||||||||| ||| ||||||| ||| ||||||||||||| |
|
|
| T |
22775699 |
gtggtggccagggtttgaaccccggaccttgcataaattatgcattgtccaaaccaactaagctaagctcacgaggac |
22775622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 120 - 183
Target Start/End: Original strand, 27718896 - 27718961
Alignment:
| Q |
120 |
gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||| | |||||||||||||||||||||| ||| || ||||||||| ||||||||||||| |
|
|
| T |
27718896 |
gtttgaactccggaccttgcatatattatgcattgtccatatcaactgagctaagctcacgaggac |
27718961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 30550716 - 30550792
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||||||| |||||||| | |||||||||| ||| ||||||||||||| |
|
|
| T |
30550716 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac |
30550792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 33743646 - 33743584
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
33743646 |
gtggtggccgaagtttgaacctcggaccttgcatattttatgcattgtcctcaccaactgagc |
33743584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 121 - 184
Target Start/End: Complemental strand, 37938553 - 37938488
Alignment:
| Q |
121 |
tttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||| |||| ||||||||||||||||| |||| |||||||||||| | |||||||||||| |
|
|
| T |
37938553 |
tttgaacctcggactttgcatatattatgcattatccataccaactgagctaaactcacgaggaca |
37938488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 120 - 170
Target Start/End: Original strand, 40919362 - 40919411
Alignment:
| Q |
120 |
gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
40919362 |
gtttgaaccc-ggaccttgcatatattatgcattgttcctaccaactgagc |
40919411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 44215465 - 44215541
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||||||| |||||||| | |||||||||| ||| ||||||||||||| |
|
|
| T |
44215465 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac |
44215541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 498802 - 498741
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||| ||||||||| |||| ||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
498802 |
gtggtgtccgaggtttaaaccacagaccttgcatatattatgcattgtccataccaactgag |
498741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 3650591 - 3650530
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||| ||||||||||| | ||||| |||||||||||||| | |||||||||||| |
|
|
| T |
3650591 |
gtggtggccggggtttgaaccccgaaccttacatatattatgcattttttctaccaactgag |
3650530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 38 - 83
Target Start/End: Complemental strand, 8618074 - 8618029
Alignment:
| Q |
38 |
gggacaatatttttttgcaaatgactcagttattatgggacggagg |
83 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||| ||| ||||| |
|
|
| T |
8618074 |
gggacaatatttttttacaaataactcagttattataggatggagg |
8618029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 120 - 169
Target Start/End: Original strand, 12160431 - 12160480
Alignment:
| Q |
120 |
gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||| |||| |
|
|
| T |
12160431 |
gtttgaaccctggaccttgcatacattatgcagtgtccctaccaagtgag |
12160480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 121 - 170
Target Start/End: Original strand, 12714373 - 12714422
Alignment:
| Q |
121 |
tttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||| | |||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
12714373 |
tttgaaccccgaaccttgcatatattatgcattgtcccttccaactgagc |
12714422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 119 - 152
Target Start/End: Complemental strand, 33105451 - 33105418
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
33105451 |
ggtttgaaccccggaccttgcatatattatgcat |
33105418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 121 - 166
Target Start/End: Original strand, 33482152 - 33482197
Alignment:
| Q |
121 |
tttgaaccctggaccttgcatatattatgcatcatccctaccaact |
166 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||| ||||| |
|
|
| T |
33482152 |
tttgaaccctggaccttgcataaattatgcattgtccctatcaact |
33482197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 5 - 83
Target Start/End: Complemental strand, 33743753 - 33743675
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagg |
83 |
Q |
| |
|
|||||||||||||| ||||||||||| || ||||||| | |||||||||||||||||||| | ||||||||| |
|
|
| T |
33743753 |
ttgtattgaaaagttaaatgagtcaatttttctggaacaatatatctttgcaaatgactcagttatcaaaggacggagg |
33743675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 133 - 183
Target Start/End: Original strand, 37015851 - 37015903
Alignment:
| Q |
133 |
accttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||| ||||||||||||| |
|
|
| T |
37015851 |
accttgcatatattatgcattgtctctaccaactgagctaagctcacgaggac |
37015903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 40167393 - 40167332
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||| |||||||| || | |||||| ||||||||||||| ||| ||||||||||| |
|
|
| T |
40167393 |
gtggtggccggggtttgaatcccgaaccttgtatatattatgcattgtccataccaactgag |
40167332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 5 - 75
Target Start/End: Original strand, 43845013 - 43845083
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgg |
75 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||| || |||||||||| ||||||||| |
|
|
| T |
43845013 |
ttgtattgaaaagtgatatgagtcaatttttatgggacaatattttcttataaatgactcaattattatgg |
43845083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 138970 - 138930
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||| ||||| |
|
|
| T |
138970 |
ttttttcgcaaatggctcagttattatgggacggatggagt |
138930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 87
Target Start/End: Complemental strand, 2119644 - 2119612
Alignment:
| Q |
55 |
caaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
2119644 |
caaatgactcagttattatggaacggagggagt |
2119612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 2489751 - 2489707
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
2489751 |
gtggtggccgaggtttgaacctcagacgttgcatatattatgcat |
2489707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 6471582 - 6471538
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||||| ||||||||||| | || ||||||||||||||||| |
|
|
| T |
6471582 |
gtggtggccggggtttgaaccccgaacattgcatatattatgcat |
6471538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 168
Target Start/End: Original strand, 7968931 - 7968990
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga |
168 |
Q |
| |
|
|||||||| | | ||||||||| |||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
7968931 |
gtggtggctgggatttgaaccc-ggaccttgcatatattatgcattgtccttaccaactga |
7968990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 40 - 80
Target Start/End: Original strand, 12958345 - 12958385
Alignment:
| Q |
40 |
gacaatatttttttgcaaatgactcagttattatgggacgg |
80 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||||| |
|
|
| T |
12958345 |
gacaatatttttttacaaaagactcagttattatgagacgg |
12958385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 112 - 152
Target Start/End: Original strand, 13124357 - 13124397
Alignment:
| Q |
112 |
tggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||| |||||||| |
|
|
| T |
13124357 |
tggccggggtttgaaccccggaccttgcatattttatgcat |
13124397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 168
Target Start/End: Complemental strand, 15020832 - 15020772
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga |
168 |
Q |
| |
|
||||||||| ||||||||||| ||| |||||||||||||| ||| ||| |||||||||| |
|
|
| T |
15020832 |
gtggtggccagggtttgaaccccggatcttgcatatattatacattgtccataccaactga |
15020772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Original strand, 15079167 - 15079203
Alignment:
| Q |
133 |
accttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
15079167 |
accttgcatatattatgcattgtccctaccaactgag |
15079203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 131 - 184
Target Start/End: Complemental strand, 23852959 - 23852904
Alignment:
| Q |
131 |
ggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||||||||||||||| ||| |||| ||||||| |||||||||||||| |
|
|
| T |
23852959 |
ggaccttgcatatattatgcattgtccataccgactgagctaagctcacgaggaca |
23852904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 184
Target Start/End: Original strand, 24023416 - 24023483
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||| | || || |||||||| |||||||||||||| |
|
|
| T |
24023416 |
ggtttgaaccccggaccttgcatattttatgcattgttccaactaactgagctaagctcacgaggaca |
24023483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 168
Target Start/End: Original strand, 24023698 - 24023758
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga |
168 |
Q |
| |
|
||||||| || ||||||||||| |||||||||| | ||||| ||| |||| |||||||||| |
|
|
| T |
24023698 |
gtggtggtcggggtttgaaccccggaccttgcagacattatacattatccataccaactga |
24023758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 121 - 153
Target Start/End: Original strand, 26773805 - 26773837
Alignment:
| Q |
121 |
tttgaaccctggaccttgcatatattatgcatc |
153 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
26773805 |
tttgaaccctagaccttgcatatattatgcatc |
26773837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 109 - 169
Target Start/End: Complemental strand, 26799254 - 26799194
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||| || ||||| ||||| | ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
26799254 |
tggtggtcggggttttaaccccgaaccttgcatattttatgcattgtccctaccaactgag |
26799194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 109 - 169
Target Start/End: Original strand, 29716691 - 29716751
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||||| ||||||| || ||||||||||||||||||| || | ||||||||||||| |
|
|
| T |
29716691 |
tggtggccggagtttgaatcccggaccttgcatatattatgaattgttcctaccaactgag |
29716751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 109 - 169
Target Start/End: Complemental strand, 32421638 - 32421579
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||| || ||| ||||||||||| |
|
|
| T |
32421638 |
tggtggccg-ggtttgaaccccggaccttgcatatattatatattgtccataccaactgag |
32421579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 33191087 - 33191127
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||| ||||||||||||||||||| |||||| |||||||| |
|
|
| T |
33191087 |
tttttgtgcaaatgactcagttattgtgggacagagggagt |
33191127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 185
Target Start/End: Original strand, 42200652 - 42200731
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacag |
185 |
Q |
| |
|
|||||| || ||||||||||| |||| |||||||||||| ||| |||||| ||||||||| ||||||||||||||| |
|
|
| T |
42200652 |
gtggtgaccaaggtttgaacctcagaccatgcatatattatacattgtccctatcaactgagctaagctcacgaggacag |
42200731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 44615537 - 44615577
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||| |||||| ||||||||| |||||||||||| |
|
|
| T |
44615537 |
tttttttgcaattgactcggttattatgagacggagggagt |
44615577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 56; Significance: 3e-23; HSPs: 120)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 3 - 87
Target Start/End: Original strand, 39329877 - 39329961
Alignment:
| Q |
3 |
tgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39329877 |
tgttgtattgaaaagtgaaatgagtcaacttttttaggacaatatttttttgcaaatgactcatttattatgggacggagggagt |
39329961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 18870715 - 18870792
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
18870715 |
gtggtggccgaggtttgaatcatggaccttgcatatattatgcattgtccctaccaactgagctaagctcacgaggac |
18870792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 5 - 87
Target Start/End: Original strand, 30261631 - 30261713
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
30261631 |
ttgtattgaaaagtgaaatgggtcaatttttttgggacaatatttttttgcaaatggctcagttattatgggacagagggagt |
30261713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 3755410 - 3755348
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
3755410 |
gtggtggccgaggtttaaaccctggaccttgcatatattatgcattgtccctaccaaccgagc |
3755348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 39 - 87
Target Start/End: Complemental strand, 9218089 - 9218041
Alignment:
| Q |
39 |
ggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9218089 |
ggacaatatttttttgcaaatgactcagttattacgggacggagggagt |
9218041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 10498685 - 10498763
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||| ||| |||||||||||| |||||||||||||| |
|
|
| T |
10498685 |
gtggtggccgaggtttgaactcatgaccttgcatatattatgcattgtccataccaactgagctaagctcacgaggaca |
10498763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 119 - 169
Target Start/End: Complemental strand, 552234 - 552184
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
552234 |
ggtttgaaccctggaccttgcatatattatgcaatatccctaccaactgag |
552184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 41 - 87
Target Start/End: Original strand, 38600970 - 38601016
Alignment:
| Q |
41 |
acaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38600970 |
acaatttttttttgcaaatgactcagttattatgggacggagggagt |
38601016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 45432019 - 45431957
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45432019 |
gtggtggccagggtttgaaccccggaccttgcatatattatgcattgtccctaccaactgagc |
45431957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 38 - 87
Target Start/End: Complemental strand, 1923040 - 1922991
Alignment:
| Q |
38 |
gggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1923040 |
gggacaatatttctttgcaaatggctcagttattatgggacggagggagt |
1922991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 108 - 182
Target Start/End: Original strand, 25340914 - 25340990
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgagga |
182 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||| |||||||| ||| |||||||||||| |||||||||||| |
|
|
| T |
25340914 |
gtggtggccggggtttgaaccccggaccttgcatattttatgcattgtccataccaactgagctaagctcacgagga |
25340990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 38130949 - 38131010
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
38130949 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccataccaactgag |
38131010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 3 - 84
Target Start/End: Original strand, 42547233 - 42547315
Alignment:
| Q |
3 |
tgttgtattgaaaagtgaaatgagtcaannnnnnngggacaata-tttttttgcaaatgactcagttattatgggacggaggg |
84 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
42547233 |
tgttgtattgaaaagtgaaatgagtcaatttttttgggacaatattttttttgcagatgactcagttattatggaatggaggg |
42547315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 5 - 87
Target Start/End: Original strand, 46194335 - 46194417
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||| || ||||| ||||||| |||||||||||||||||| |
|
|
| T |
46194335 |
ttgtattgaaaagtgaaatgggtcaatttttctgggacaatatttttctgaaaatggctcagttgttatgggacggagggagt |
46194417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 121 - 183
Target Start/End: Original strand, 48315027 - 48315091
Alignment:
| Q |
121 |
tttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||| |||||||||||| ||||||||||||| |
|
|
| T |
48315027 |
tttgaaccccggaccttgcatatattatgcattatccttaccaactgagctaagctcacgaggac |
48315091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 51882190 - 51882251
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||||||||| ||| ||||||||||| |
|
|
| T |
51882190 |
gtggtggccggggtttgaaccctggatcttgcatatattatgcattgtccataccaactgag |
51882251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 53754190 - 53754276
Alignment:
| Q |
1 |
aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||| ||||||||||||| | ||||||| |||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
53754190 |
aatgttgtattgaaaactgaaatgagtcaagattactgtgacaataattttttataaatgactcagttattatgggacggagcgagt |
53754276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 1334946 - 1334986
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1334946 |
tttttttgcaaatgactcagttattatgggacggagggagt |
1334986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 171
Target Start/End: Original strand, 8136622 - 8136685
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagca |
171 |
Q |
| |
|
||||||| || |||||||||| |||||||||||||||||||||||| ||| ||||||| ||||| |
|
|
| T |
8136622 |
gtggtggtcggggtttgaaccttggaccttgcatatattatgcatcgtccataccaaccgagca |
8136685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 16792964 - 16793042
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||| || ||||||||| || |||||||||||||| |
|
|
| T |
16792964 |
gtggtgaccggggtttgaaccctggaccttgcatatattatgcattgtctataccaactgtgctaagctcacgaggaca |
16793042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 180
Target Start/End: Complemental strand, 27185548 - 27185474
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgag |
180 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||||||| || |||||||||||||||| |||||||||| |
|
|
| T |
27185548 |
gtggtggtcgaggtttgaaccccagaccttgcatatattatgtattgtccctaccaactgagctaagctcacgag |
27185474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 112 - 184
Target Start/End: Original strand, 43777051 - 43777124
Alignment:
| Q |
112 |
tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||| |||||||||||||||| ||||||||| |||| |
|
|
| T |
43777051 |
tggccgaggtttgaaccc-gaaccttgcatatattatgcatggtccctaccaactgagctaagctcacgaagaca |
43777124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 48409566 - 48409482
Alignment:
| Q |
1 |
aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggaggga |
85 |
Q |
| |
|
|||||||||||||||| ||||||| ||||| ||||||||||||||| |||||| ||||||||||| |||||||||||| |
|
|
| T |
48409566 |
aatgttgtattgaaaactgaaatgggtcaagattcctaggacaatatttttttacaaatggctcagttattacgggacggaggga |
48409482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 114 - 168
Target Start/End: Original strand, 759590 - 759644
Alignment:
| Q |
114 |
gccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga |
168 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||| |||||||||||||| |
|
|
| T |
759590 |
gccgaggtttgaaccctgaactttgcatatattatgcattgtccctaccaactga |
759644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 119 - 186
Target Start/End: Original strand, 1149070 - 1149139
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacaga |
186 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||| ||| |||||||||||| |||||||||||||||| |
|
|
| T |
1149070 |
ggttcgaaccctagaccttgcatatattatgcattgtccttaccaactgagctaagctcacgaggacaga |
1149139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 7464481 - 7464558
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggac |
183 |
Q |
| |
|
||||||| || ||||||||||| ||||||| |||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
7464481 |
gtggtggtcggggtttgaaccccggaccttacatatattatgcattgtccctaccaactgagttaagctcacgaggac |
7464558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 119 - 169
Target Start/End: Original strand, 16663237 - 16663287
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
16663237 |
ggtttgaaccccggaccttgcatatattatgcattatccataccaactgag |
16663287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 25441490 - 25441552
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
25441490 |
gtggtggccggggtttgaaccccagaccttgcatatattatgcattgtccataccaactgagc |
25441552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 109 - 184
Target Start/End: Complemental strand, 34899167 - 34899090
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||| || ||||||||||| |||||||||||||||||||||| ||||||| |||||||| || ||||||||||| |
|
|
| T |
34899167 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgtccctacgaactgagctaagatcacgaggaca |
34899090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 35863803 - 35863865
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| || ||| |||||||||||| |
|
|
| T |
35863803 |
gtggtggccgaggtttgaaccccagaccttgcatatattatgtattgtccttaccaactgagc |
35863865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 108 - 186
Target Start/End: Original strand, 32843252 - 32843332
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacaga |
186 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| |||||||| ||| ||||||||||| |||||||||||||||| |
|
|
| T |
32843252 |
gtggtggccggggtttgaaccccagaccttgcatattttatgcattgtccaaaccaactgagctaagctcacgaggacaga |
32843332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 38 - 87
Target Start/End: Complemental strand, 47496122 - 47496073
Alignment:
| Q |
38 |
gggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
47496122 |
gggacaatatttttttacaaatgactcagttattacaggacggagggagt |
47496073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 913590 - 913634
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
913590 |
gtggtggcagaggtttgaaccccggaccttgcatatattatgcat |
913634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 48849753 - 48849797
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
48849753 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcat |
48849797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 7557524 - 7557602
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggaca |
184 |
Q |
| |
|
|||||||||||||||||| | | |||||||||||| ||||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
7557524 |
gtggtggccgaggtttgatcgccggaccttgcatacattatgcattgtccataccaactgagttaagctcacgaggaca |
7557602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 10926540 - 10926462
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||||||| ||||||||| | |||||||||||||||||||| ||| |||||||||||| |||| ||||||||| |
|
|
| T |
10926540 |
gtggtggccgacatttgaaccccgaaccttgcatatattatgcattgtccttaccaactgagctaagcttacgaggaca |
10926462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 119 - 174
Target Start/End: Original strand, 27065733 - 27065788
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagcagct |
174 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||| ||||||||| ||||| |
|
|
| T |
27065733 |
ggtttgaaccctggaccttgcatattttatgcattgtcccaaccaactgatcagct |
27065788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 111 - 170
Target Start/End: Original strand, 38034802 - 38034861
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||| || |||| ||||||||||| |
|
|
| T |
38034802 |
gtggccgaggtttgaaccccggaccttgcatattttatgtattgtcccaaccaactgagc |
38034861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 166
Target Start/End: Complemental strand, 10102870 - 10102812
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaact |
166 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||| |||||||||| |||||||||||| |
|
|
| T |
10102870 |
gtggtggccggggtttgaaccctggattttgcatgtattatgcattgtccctaccaact |
10102812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 166
Target Start/End: Complemental strand, 10213793 - 10213735
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaact |
166 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||| |||||||||| |||||||||||| |
|
|
| T |
10213793 |
gtggtggccggggtttgaaccctggattttgcatgtattatgcattgtccctaccaact |
10213735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 119 - 169
Target Start/End: Original strand, 10922309 - 10922359
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
10922309 |
ggtttgaaccccggatcttgcatatattatgcattgtccctaccaactgag |
10922359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 121 - 184
Target Start/End: Original strand, 16980357 - 16980422
Alignment:
| Q |
121 |
tttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||| || |||||||||||||||||||| ||| |||||||||||| |||||||||||||| |
|
|
| T |
16980357 |
tttgaaccatgaaccttgcatatattatgcattgtccttaccaactgagctaagctcacgaggaca |
16980422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 29631257 - 29631195
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||| |||||||| || | |||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
29631257 |
gtggtggccggggtttgaatcccgaaccttgcatatattatgcattgtccataccaactgagc |
29631195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 150
Target Start/End: Original strand, 35210121 - 35210163
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgc |
150 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
35210121 |
gtggtggccgaggtttgaaccccggaccttgcatattttatgc |
35210163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 8 - 87
Target Start/End: Complemental strand, 39143737 - 39143658
Alignment:
| Q |
8 |
tattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||| ||||||| |||| |||||||||||||||||||| |
|
|
| T |
39143737 |
tattgaaaagtgaaatgagtcaatttttttgaaacaatattttttggcaaatggctcacctattatgggacggagggagt |
39143658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 119 - 186
Target Start/End: Complemental strand, 44579696 - 44579627
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacaga |
186 |
Q |
| |
|
|||| |||||| ||||||||||||| |||||||| ||| |||||||||||| |||||||||||||||| |
|
|
| T |
44579696 |
ggttcgaaccccggaccttgcatattttatgcattgtccataccaactgagctaagctcacgaggacaga |
44579627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 55066590 - 55066652
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||| | ||||||||| |||| |||||||||||||||| |||| |||||||||||| |
|
|
| T |
55066590 |
gtggtggccgggatttgaaccccagaccatgcatatattatgcattatccgtaccaactgagc |
55066652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 4601915 - 4601854
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||| |||||||||| ||| |||||||||| |
|
|
| T |
4601915 |
gtggtggccggggtttgaaccccggaccttgcatttattatgcattgtccaaaccaactgag |
4601854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 115 - 152
Target Start/End: Original strand, 5428433 - 5428470
Alignment:
| Q |
115 |
ccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5428433 |
ccgaggtttgaatcctggaccttgcatatattatgcat |
5428470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 122 - 184
Target Start/End: Complemental strand, 7738726 - 7738662
Alignment:
| Q |
122 |
ttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggaca |
184 |
Q |
| |
|
|||||||| ||||||||||||| |||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
7738726 |
ttgaaccccggaccttgcatattttatgcattgtccctaccaactgagttaagctcacgaggaca |
7738662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 39100073 - 39100118
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccct-ggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
39100073 |
gtggtggccgaggtttgaaccatcggaccttgcatatattatgcat |
39100118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 38 - 83
Target Start/End: Complemental strand, 41286991 - 41286947
Alignment:
| Q |
38 |
gggacaatatttttttgcaaatgactcagttattatgggacggagg |
83 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
41286991 |
gggacaatatttttt-gcaaatgactcatttattatgggacggagg |
41286947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 45746343 - 45746261
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||| |||||| |||||| | |||||||||||||||||||||| |||||||||||| |||||| |||| |
|
|
| T |
45746343 |
ttgtattgaaaactgaaataagtcaatttttttgtgacaatatttttttgcaaatgaatcagttattatgaaacggagagagt |
45746261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 120 - 169
Target Start/End: Complemental strand, 46903967 - 46903918
Alignment:
| Q |
120 |
gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
46903967 |
gtttgaaccctggaccttacatatattatgcattgtccataccaactgag |
46903918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 109 - 170
Target Start/End: Complemental strand, 52119446 - 52119385
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||| |||| |||||| | |||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
52119446 |
tggtggccggggttcgaaccccgaaccttgcatatattatgcattgtccttaccaactgagc |
52119385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 54243456 - 54243395
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||||||||||||||| ||| ||| |||||||||||||| | | ||||||||||| |
|
|
| T |
54243456 |
gtggtggccgaggtttgaaccccggatcttaaatatattatgcatcgtgcttaccaactgag |
54243395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 334837 - 334881
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||| |||||||| |
|
|
| T |
334837 |
gtggtggccggggtttgaaccccggaccttgcatattttatgcat |
334881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 2453884 - 2453840
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
2453884 |
gtggtggccgaggttcgaaccctaaaccttgcatatattatgcat |
2453840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 32023271 - 32023311
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
32023271 |
tttttttgcaattgactcagttattatgggacgaagggagt |
32023311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 121 - 169
Target Start/End: Original strand, 35126272 - 35126320
Alignment:
| Q |
121 |
tttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||||| || |||||||||||||||||| |||||||||||||||| |
|
|
| T |
35126272 |
tttgaaccccagatcttgcatatattatgcattatccctaccaactgag |
35126320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 38603029 - 38602985
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||||| |||||||||| || |||||||||||||||||||| |
|
|
| T |
38603029 |
gtggtggccggggtttgaaccatgaaccttgcatatattatgcat |
38602985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 43640742 - 43640782
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
43640742 |
tttttttgcaaataactcagttattatgggacagagggagt |
43640782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 44582796 - 44582717
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcata-tattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| |||| |||||| |||||||||||| |||||||||| || |||||||||||| |||||||||||||| |
|
|
| T |
44582796 |
gtggtggccggggttcgaaccccggaccttgcatattattatgcattgcccataccaactgagctgagctcacgaggaca |
44582717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 112 - 152
Target Start/End: Original strand, 48656893 - 48656933
Alignment:
| Q |
112 |
tggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
48656893 |
tggctgaggtttgaaccccggaccttgcatatattatgcat |
48656933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 51164885 - 51164845
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
51164885 |
tttttttgcaaatggctgagttattatgggacggagggagt |
51164845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 3100292 - 3100214
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| |||| |||||||||| |||||||| |||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
3100292 |
gtggtggccggggttcaaaccctggactttgcatatgttatgcattgtccacaccaactgagctaagctcacgaggaca |
3100214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 120 - 184
Target Start/End: Original strand, 4332669 - 4332735
Alignment:
| Q |
120 |
gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||| || | ||||||||||| |||||||||||||| |
|
|
| T |
4332669 |
gtttgaaccccggaccttggatatattatgcattattcaaaccaactgagctaagctcacgaggaca |
4332735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 109 - 168
Target Start/End: Complemental strand, 10594747 - 10594688
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga |
168 |
Q |
| |
|
||||| || ||||||||||||| |||||||||||||||||||| ||| |||||||||| |
|
|
| T |
10594747 |
tggtgtccaaggtttgaaccctaaaccttgcatatattatgcattgtccttaccaactga |
10594688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 180
Target Start/End: Complemental strand, 14827596 - 14827522
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgag |
180 |
Q |
| |
|
|||||||||| ||||| ||||| ||| ||||||||| |||||||| ||| |||||||||||| |||||||||| |
|
|
| T |
14827596 |
gtggtggccggggtttaaaccccggatcttgcatattttatgcattgtccataccaactgagctaagctcacgag |
14827522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 119 - 170
Target Start/End: Complemental strand, 17218551 - 17218500
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||||| || ||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
17218551 |
ggtttgaaccccggcccttgcatataatatgcaatatccctaccaactgagc |
17218500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 47 - 82
Target Start/End: Original strand, 21296680 - 21296715
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggag |
82 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
21296680 |
tttttttgcaaatgactcagttattgtgggacggag |
21296715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 21331407 - 21331485
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||| ||||||| || |||||| | |||||||||||||||||||| ||| || ||||||||| |||||||||||||| |
|
|
| T |
21331407 |
gtggcggccgagattcgaaccccgaaccttgcatatattatgcattgtccataacaactgagctaagctcacgaggaca |
21331485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 120 - 184
Target Start/End: Original strand, 21628890 - 21628956
Alignment:
| Q |
120 |
gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| |||| ||| ||||||||||||| |||| ||||||||||| |||||||||||||| |
|
|
| T |
21628890 |
gtttgaaccccggacgttggatatattatgcattatccaaaccaactgagctaagctcacgaggaca |
21628956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 48 - 87
Target Start/End: Original strand, 24619086 - 24619125
Alignment:
| Q |
48 |
ttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
24619086 |
ttttttgcaaatgactcagttagtatgagacggagggagt |
24619125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 32629151 - 32629073
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||| ||| ||| |||||| ||||||||||||| |||||||| ||| |||||||||||| |||||||| ||||| |
|
|
| T |
32629151 |
gtggtggtcgatgttcgaaccccggaccttgcatattttatgcattgtccataccaactgagctaagctcacgtggaca |
32629073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 36483747 - 36483669
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| |||| |||||| | ||||| ||||||||||||| ||||| |||||||||| |||||||||||||| |
|
|
| T |
36483747 |
gtggtggccggggttcgaacccaaggccttgtatatattatgcattgtccctgccaactgagcaaagctcacgaggaca |
36483669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 131 - 170
Target Start/End: Complemental strand, 48511298 - 48511259
Alignment:
| Q |
131 |
ggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48511298 |
ggaccttgcatatattatgcattgtccctaccaactgagc |
48511259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 47 - 82
Target Start/End: Complemental strand, 48744161 - 48744126
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggag |
82 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48744161 |
tttttttgcaaatggctcagttattatgggacggag |
48744126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 40 - 87
Target Start/End: Original strand, 50150531 - 50150578
Alignment:
| Q |
40 |
gacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||| | ||||||||| |
|
|
| T |
50150531 |
gacaatatttttttgcaaatgacccacttattatggaatggagggagt |
50150578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 124 - 184
Target Start/End: Original strand, 53633623 - 53633685
Alignment:
| Q |
124 |
gaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggaca |
184 |
Q |
| |
|
|||||| ||||||| |||||||||||||| |||| ||||||||||| |||||||||||||| |
|
|
| T |
53633623 |
gaaccccggaccttacatatattatgcattatccttaccaactgagttaagctcacgaggaca |
53633685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 53996370 - 53996292
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| | || |||||| ||||||||||||||||||||| ||| |||||||||||| ||||||| |||||| |
|
|
| T |
53996370 |
gtggtggccgggattcgaaccccagaccttgcatatattatgcattgtccataccaactgagctaagctcacaaggaca |
53996292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 916510 - 916434
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||||||| |||||||| | |||||||||| ||| ||||||||||||| |
|
|
| T |
916510 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac |
916434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 11358305 - 11358243
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||| ||||||||||| ||| ||||||||||||||| || || |||||||| |||| |
|
|
| T |
11358305 |
gtggtggccggggtttgaaccccggatcttgcatatattatgaattgtcgctaccaaccgagc |
11358243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 109 - 159
Target Start/End: Original strand, 21567678 - 21567728
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccct |
159 |
Q |
| |
|
||||||| || |||||||||||| ||||||||||||||||| || |||||| |
|
|
| T |
21567678 |
tggtggctgaagtttgaaccctgaaccttgcatatattatgtattatccct |
21567728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 87
Target Start/End: Original strand, 36097829 - 36097867
Alignment:
| Q |
49 |
tttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
36097829 |
tttttgcaaatgactcagttattatgagacggagtgagt |
36097867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 169
Target Start/End: Complemental strand, 41817559 - 41817509
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
41817559 |
ggtttgaaccccggaccttgcatatattatgcattgtccaaaccaactgag |
41817509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 48796208 - 48796285
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||| ||||||||||| | ||||||||||| |||||||| ||| || |||||||| ||||||||||||| |
|
|
| T |
48796208 |
gtggtggccggggtttgaaccccgaaccttgcatatcttatgcattgtccaaactaactgagctaagctcacgaggac |
48796285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 121 - 170
Target Start/End: Original strand, 977944 - 977993
Alignment:
| Q |
121 |
tttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||| | |||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
977944 |
tttgaactccggaccttgcatatattatgcattgtccataccaactgagc |
977993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 3176964 - 3177024
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||| ||||| ||||| | |||||||||||||||||||| | ||||||||||||| |
|
|
| T |
3176964 |
gtggtggccgtggtttaaacccag-accttgcatatattatgcattgttcctaccaactgag |
3177024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 42 - 87
Target Start/End: Original strand, 17777146 - 17777191
Alignment:
| Q |
42 |
caatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||| ||||||||||||| ||||| ||||||||||| ||||||||| |
|
|
| T |
17777146 |
caatttttttttgcaaattactcaattattatgggatggagggagt |
17777191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 42 - 87
Target Start/End: Original strand, 19078447 - 19078492
Alignment:
| Q |
42 |
caatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||| ||||||||||||| ||||| ||||||||||| ||||||||| |
|
|
| T |
19078447 |
caatttttttttgcaaattactcaattattatgggatggagggagt |
19078492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 111 - 152
Target Start/End: Complemental strand, 20018265 - 20018224
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
20018265 |
gtggccgaggtttgaaccccagaccttgcatattttatgcat |
20018224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 20079793 - 20079732
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||||||||||||||| | |||| |||||||||||||| ||| || |||| ||||||| |
|
|
| T |
20079793 |
gtggtggccgaggtttgaatcttggatcttgcatatattatacattgtctctactaactgag |
20079732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 186
Target Start/End: Complemental strand, 22722473 - 22722393
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacaga |
186 |
Q |
| |
|
||||||| || |||||||||| ||||||||||||| |||||||| | | ||| |||||||| |||||||||||||||| |
|
|
| T |
22722473 |
gtggtggtcggggtttgaacctcggaccttgcatattttatgcattgttcatactaactgagctaagctcacgaggacaga |
22722393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 112 - 186
Target Start/End: Original strand, 27999691 - 27999767
Alignment:
| Q |
112 |
tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacaga |
186 |
Q |
| |
|
|||||| ||||||||||| ||| ||||||| | || |||| |||| |||||||||||| |||||||||||||||| |
|
|
| T |
27999691 |
tggccggggtttgaaccccagactttgcatacaatacgcattatccataccaactgagctaagctcacgaggacaga |
27999767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 32909291 - 32909352
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||| | ||||||||| ||||||||||||| |||||||| ||| ||| ||||||| |
|
|
| T |
32909291 |
gtggtggccgggatttgaacccaggaccttgcatattttatgcattgtccatactaactgag |
32909352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 119 - 185
Target Start/End: Original strand, 35191818 - 35191886
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacag |
185 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||| ||| |||||||||||| ||| ||||||||||| |
|
|
| T |
35191818 |
ggttcgaaccccagaccttgcatatattatgcattgtccttaccaactgagctaagcgcacgaggacag |
35191886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 111 - 152
Target Start/End: Original strand, 35347288 - 35347329
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35347288 |
gtggtcgaggtttgaaccccagaccttgcatatattatgcat |
35347329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 121 - 170
Target Start/End: Complemental strand, 36431867 - 36431818
Alignment:
| Q |
121 |
tttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||| ||| ||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
36431867 |
tttgaaccccagacattgcatatattatacattatccctaccaactgagc |
36431818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 38 - 87
Target Start/End: Original strand, 39365179 - 39365228
Alignment:
| Q |
38 |
gggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||| | |||||| | ||||| |||||||||||||||||||||||||| |
|
|
| T |
39365179 |
gggacacttttttttggtaaatggctcagttattatgggacggagggagt |
39365228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 40520823 - 40520762
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||| || ||||||||| |||||||||||||| |||||||| |||| ||| ||||||| |
|
|
| T |
40520823 |
gtggtggtcggggtttgaactttggaccttgcatattttatgcattatccatacaaactgag |
40520762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 111 - 152
Target Start/End: Original strand, 42886502 - 42886543
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||||||||||||||| | ||||||||||| |||||||| |
|
|
| T |
42886502 |
gtggccgaggtttgaaccccgaaccttgcatattttatgcat |
42886543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 109 - 170
Target Start/End: Original strand, 45885468 - 45885529
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
45885468 |
tggtggccggggtttgaacctcagaccttgcatatattatgcaaggtccataccaactgagc |
45885529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 168
Target Start/End: Original strand, 1456530 - 1456590
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga |
168 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||| ||| |||||| ||||||| |
|
|
| T |
1456530 |
gtggtggccgagttttgaacctcagaccttgcatatattatacattgtccctatcaactga |
1456590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 168
Target Start/End: Original strand, 1743980 - 1744040
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga |
168 |
Q |
| |
|
||||||||||| ||| |||||| | ||||||||||||||||| || ||| |||||||||| |
|
|
| T |
1743980 |
gtggtggccgaagttcgaaccccgaaccttgcatatattatgtattgtccataccaactga |
1744040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 170
Target Start/End: Complemental strand, 2445582 - 2445522
Alignment:
| Q |
110 |
ggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||| |||||||||||| ||||||| | |||||||| ||| ||| |||||||||||| |
|
|
| T |
2445582 |
ggtggcctaggtttgaaccccggacctttcgtatattatacattgtccttaccaactgagc |
2445522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 4825410 - 4825366
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||| ||||||| |||||| ||||||| |||||||||||||| |
|
|
| T |
4825410 |
gtggtggtcgaggttcgaaccccggacctttcatatattatgcat |
4825366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 135 - 184
Target Start/End: Original strand, 7974529 - 7974580
Alignment:
| Q |
135 |
cttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||| ||||||||| |||| |
|
|
| T |
7974529 |
cttgcatatattatgcattatccataccaactgagctaagctcacgacgaca |
7974580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 8075856 - 8075812
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
8075856 |
gtggtggccggggtttgaacctcagaccttgcatatattatgcat |
8075812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 8238635 - 8238591
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
8238635 |
gtggtggccggagtttgaaccccagaccttgcatatattatgcat |
8238591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 118 - 170
Target Start/End: Original strand, 11250597 - 11250649
Alignment:
| Q |
118 |
aggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||| |||||| ||||| |||||||| |||||| ||||||||||||||||| |
|
|
| T |
11250597 |
aggttcgaaccccggaccctgcatataatatgcaatatccctaccaactgagc |
11250649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 116 - 148
Target Start/End: Original strand, 17476745 - 17476777
Alignment:
| Q |
116 |
cgaggtttgaaccctggaccttgcatatattat |
148 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
17476745 |
cgaggtttgaaccctagaccttgcatatattat |
17476777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 22251450 - 22251494
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||||| |||| |||||| ||||| |||||||||||||||| |
|
|
| T |
22251450 |
gtggtggccggggttcgaaccccggaccgtgcatatattatgcat |
22251494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 185
Target Start/End: Original strand, 22799716 - 22799795
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacag |
185 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||| | |||||||| ||| ||| |||||||| |||||||||||||| |
|
|
| T |
22799716 |
gtggtggtcgaggtttgaacctcggaccttgcatgttttatgcattgtccttacaaactgagctatgctcacgaggacag |
22799795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 25727957 - 25728001
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||| || | ||||||||| |||||||||||||||||||||| |
|
|
| T |
25727957 |
gtggtggtcgggatttgaaccccggaccttgcatatattatgcat |
25728001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 124 - 168
Target Start/End: Complemental strand, 28266771 - 28266727
Alignment:
| Q |
124 |
gaaccctggaccttgcatatattatgcatcatccctaccaactga |
168 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
28266771 |
gaaccccggaccttgcatatattatgcattgtccttaccaactga |
28266727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 148
Target Start/End: Complemental strand, 32651715 - 32651675
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattat |
148 |
Q |
| |
|
||||| ||||||||||||||| || |||||||||||||||| |
|
|
| T |
32651715 |
gtggttgccgaggtttgaaccatgaaccttgcatatattat |
32651675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 44075146 - 44075190
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||||||| |||||||| |
|
|
| T |
44075146 |
gtggtggccggggtttgaactccggaccttgcatattttatgcat |
44075190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 44234026 - 44233986
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||| |||||||||| || |||||||| |
|
|
| T |
44234026 |
tttttttgcaaatgactctgttattatggaacagagggagt |
44233986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 184
Target Start/End: Original strand, 52904144 - 52904211
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||| ||| |||||||||||| | |||||||||||| |
|
|
| T |
52904144 |
ggtttgaacccccgacattgcatatattatgcattgtccttaccaactgagctaacctcacgaggaca |
52904211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 55; Significance: 1e-22; HSPs: 132)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 10735821 - 10735898
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
10735821 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcatcgtccctaccaactgagctaagctcacgaggac |
10735898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 13222046 - 13221965
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13222046 |
ttgtattgaaaagtgaaatg-gtcaatttttatgggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
13221965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 35820291 - 35820368
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
35820291 |
gtggtggccgaggtttgaaccccggaccttgcatgtattatgcattgtccctaccaactgagctaagctcacgaggac |
35820368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 314413 - 314331
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
314413 |
ttgtattgaaaagtgaaatggatcaatttttctaggacaatatttttttgcaaatgactcagttattatgggacggggggagt |
314331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 5425835 - 5425753
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
5425835 |
ttgtattgaaaagtgaaatgagacagttttcttgggacaatatttttttgcaaatggctcacttattatgggacggagggagt |
5425753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 109 - 170
Target Start/End: Complemental strand, 30089119 - 30089058
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
30089119 |
tggtggccgaggtttgaaccccggaccttgtatatattatgcattgtccctaccaactgagc |
30089058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 109 - 170
Target Start/End: Complemental strand, 30125723 - 30125662
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
30125723 |
tggtggccgaggtttgaaccccggaccttgtatatattatgcattgtccctaccaactgagc |
30125662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 31348489 - 31348407
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||| ||||||| ||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31348489 |
ttgtattgaaaattgaaatgggtcaatttttctaggacaatatttttttgcaaatggctcagttattatgggacggagggagt |
31348407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 5 - 75
Target Start/End: Complemental strand, 31592529 - 31592459
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgg |
75 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31592529 |
ttgtattgaaaagtgaaatgagtcaatttttttgggacaatattattttgcaaatgactcagttattatgg |
31592459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 3 - 81
Target Start/End: Complemental strand, 44260554 - 44260476
Alignment:
| Q |
3 |
tgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacgga |
81 |
Q |
| |
|
||||||||||||||||||||||| |||| | |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44260554 |
tgttgtattgaaaagtgaaatgaatcaacttttttgagacaatatttttttgcaaatgattcagttattatgggacgga |
44260476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 39 - 81
Target Start/End: Complemental strand, 2427301 - 2427259
Alignment:
| Q |
39 |
ggacaatatttttttgcaaatgactcagttattatgggacgga |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2427301 |
ggacaatatttttttgcaaatgactcagttattatgggacgga |
2427259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 24592836 - 24592898
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24592836 |
gtggtggccggggtttgaaccccagaccttgcatatattatgcattgtccctaccaactgagc |
24592898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 29544698 - 29544636
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
29544698 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccctaccaattgagc |
29544636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 38 - 87
Target Start/End: Original strand, 6685831 - 6685880
Alignment:
| Q |
38 |
gggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
6685831 |
gggacaatatttttttgcaaatcactccgttattatgggacggagggagt |
6685880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 46 - 87
Target Start/End: Original strand, 20696951 - 20696992
Alignment:
| Q |
46 |
atttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20696951 |
atttttttgcaaatgactcagttattatgggacggagggagt |
20696992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 31815877 - 31815938
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||| || ||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31815877 |
gtggtggtcggggtttgaaccccggaccttgcatatattatgcattgtccctaccaactgag |
31815938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 20200776 - 20200732
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
20200776 |
gtggtggccggggtttgaaccctggaccttgcatatattatgcat |
20200732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 119 - 180
Target Start/End: Original strand, 20565076 - 20565139
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgag |
180 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
20565076 |
ggtttgaaccccggaccttgcatatattatgcattgtccctaccaactgagctaagctcacgag |
20565139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 119 - 184
Target Start/End: Complemental strand, 31543072 - 31543005
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||| ||||| |||||| |||||||||||||| |
|
|
| T |
31543072 |
ggtttgaaccccggaccttgcatatattatgcattatccataccatctgagctaagctcacgaggaca |
31543005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 121 - 184
Target Start/End: Complemental strand, 27244715 - 27244650
Alignment:
| Q |
121 |
tttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||| ||||||||| |||||||||||||| |
|
|
| T |
27244715 |
tttgaaccctagaccttgcatatattatgcattgtccctatcaactgagctaagctcacgaggaca |
27244650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 30243321 - 30243259
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||||||||||||||| | |||||| ||||||||||||| || ||||||||||||| |
|
|
| T |
30243321 |
gtggtggccgaggtttgaaccccgaaccttgtatatattatgcattgtctctaccaactgagc |
30243259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 660813 - 660870
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaact |
166 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
660813 |
tggtggtcggggtttgaaccctggaccttgcatatattatgcattgtccataccaact |
660870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 7213453 - 7213371
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||||||| | || |||||| | |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7213453 |
ttgtattgaaaagtgaaatgatttaattattttgggacacttattttttgcaaatgactcacttattatgggacggagggagt |
7213371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 9472404 - 9472330
Alignment:
| Q |
1 |
aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgg |
75 |
Q |
| |
|
|||||||||||||||||||||||| || || ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9472404 |
aatgttgtattgaaaagtgaaatgggttaatattctctggacaatatttttttacaaatgactcagttattatgg |
9472330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 23250310 - 23250371
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||||||||| | | ||||||||||| |
|
|
| T |
23250310 |
gtggtggtcggggtttgaaccctggaccttgcatatattatgcattgttcttaccaactgag |
23250371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 24356093 - 24356007
Alignment:
| Q |
1 |
aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||||||| |||||| ||||||| ||||||||||||||| |
|
|
| T |
24356093 |
aatgttgtattgaaaagtgaaatgggtcaagattcttgggacaatatttttttacaaatgggtcagttaaactgggacggagggagt |
24356007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 109 - 183
Target Start/End: Complemental strand, 44526198 - 44526122
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
||||||||| |||||||| || ||||||||| |||||||||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
44526198 |
tggtggccggggtttgaatcccggaccttgcgtatattatgcattgtccataccaactgagctaagctcacgaggac |
44526122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 119 - 184
Target Start/End: Original strand, 346125 - 346192
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| || | ||||||||||| |||||||||||||| |
|
|
| T |
346125 |
ggtttgaaccctggaccttacatatattatgcattattcaaaccaactgagctaagctcacgaggaca |
346192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 3123580 - 3123540
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3123580 |
tttttttgcaattgactcagttattatgggacggagggagt |
3123540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 39 - 87
Target Start/End: Complemental strand, 6075440 - 6075392
Alignment:
| Q |
39 |
ggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
6075440 |
ggacaatatttttttgcaaatagctcagttattatggaacggagggagt |
6075392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 7649025 - 7649065
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7649025 |
tttttttgcaaatgactcagttattatggaacggagggagt |
7649065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 25604289 - 25604249
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
25604289 |
tttttttgcaaatgactcagttattataggacggagggagt |
25604249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 27848229 - 27848185
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
27848229 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcat |
27848185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 28108553 - 28108593
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28108553 |
tttttttgcaaatggctcagttattatgggacggagggagt |
28108593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 36359385 - 36359341
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
36359385 |
gtggtggccaaggtttgaaccccggaccttgcatatattatgcat |
36359341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 112 - 184
Target Start/End: Complemental strand, 7206192 - 7206118
Alignment:
| Q |
112 |
tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||| ||||| |||| |||||||||||||||||||||| || ||||||||||||| |||||||||||||| |
|
|
| T |
7206192 |
tggccggggtttaaacctcggaccttgcatatattatgcattgtctctaccaactgagctaagctcacgaggaca |
7206118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 147
Target Start/End: Original strand, 7645704 - 7645743
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatatta |
147 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7645704 |
gtggtggccgaggtttgaaccctggactttgcatatatta |
7645743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 119 - 170
Target Start/End: Complemental strand, 11560558 - 11560507
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
11560558 |
ggtttgaaccctgaaccttgcatatattatgcattgtccctaccaattgagc |
11560507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 20455962 - 20455884
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| | || |||||| |||||||||||||||||||||| ||| |||||| ||||| |||||||||||||| |
|
|
| T |
20455962 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattgtccataccaattgagctaagctcacgaggaca |
20455884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 119 - 170
Target Start/End: Original strand, 25598563 - 25598614
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
25598563 |
ggttcgaaccctggaccttgcatatattatgcattgtccataccaactgagc |
25598614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 27411163 - 27411085
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| |||| |||||| ||||||||||||||||||||| ||| || ||||||||| |||||||||||||| |
|
|
| T |
27411163 |
gtggtggccggggttcgaaccccggaccttgcatatattatgcaaggtccatatcaactgagctaagctcacgaggaca |
27411085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 48 - 87
Target Start/End: Complemental strand, 40964988 - 40964949
Alignment:
| Q |
48 |
ttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40964988 |
ttttttgcaaatgactcagttattatgggactgagggagt |
40964949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 42066783 - 42066705
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||| ||||| ||| |||||||||||| ||||||||| |||| |
|
|
| T |
42066783 |
gtggtggccgaggttcaaaccccggaccttgcatatattgtgcattgtccataccaactgagctaagctcacgatgaca |
42066705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 112 - 183
Target Start/End: Original strand, 1861803 - 1861876
Alignment:
| Q |
112 |
tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||||| ||| || || |||||| ||||||||||||| |
|
|
| T |
1861803 |
tggccgatgtttgaaccatggaccttgcatatattatgcattgtccatatcagctgagctaagctcacgaggac |
1861876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 2257042 - 2256965
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggac |
183 |
Q |
| |
|
|||||||||| |||| |||||| ||||||||||||||||||||| ||| ||||||||||| ||||||||||||| |
|
|
| T |
2257042 |
gtggtggccggggttcgaaccccagaccttgcatatattatgcattgtccataccaactgagttaagctcacgaggac |
2256965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 112 - 170
Target Start/End: Original strand, 4927443 - 4927501
Alignment:
| Q |
112 |
tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||| ||||||||||| ||||||| |||||||||||| | |||||||||||||||| |
|
|
| T |
4927443 |
tggccggggtttgaaccccggaccttacatatattatgctttgtccctaccaactgagc |
4927501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 119 - 169
Target Start/End: Original strand, 5168580 - 5168630
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||||||| | |||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
5168580 |
ggtttgaaccccgaaccttgcatatattatgcattatccctatcaactgag |
5168630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 25186232 - 25186294
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||| | ||||||||||| |||||||||||||||||||||| ||| || ||||||||| |
|
|
| T |
25186232 |
gtggtggctggggtttgaaccccggaccttgcatatattatgcattgtccatatcaactgagc |
25186294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 119 - 169
Target Start/End: Complemental strand, 27152413 - 27152363
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27152413 |
ggttcgaaccccagaccttgcatatattatgcattatccctaccaactgag |
27152363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 112 - 170
Target Start/End: Complemental strand, 30978429 - 30978371
Alignment:
| Q |
112 |
tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||||| |||| |||||| ||||| |
|
|
| T |
30978429 |
tggcagaggtttgaacccctgaccttgcatatattatgcattatccataccaattgagc |
30978371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 31477042 - 31476980
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||| | ||||||||| | |||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
31477042 |
gtggtggccgggatttgaaccccgaaccttgtatatattatgcattctccctaccaactgagc |
31476980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 38 - 87
Target Start/End: Original strand, 6972706 - 6972755
Alignment:
| Q |
38 |
gggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||| ||||||| ||| ||||||| |||||||||||||| |
|
|
| T |
6972706 |
gggacaatattttttagcaaatggctcggttattacgggacggagggagt |
6972755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 117 - 170
Target Start/End: Complemental strand, 12124607 - 12124554
Alignment:
| Q |
117 |
gaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
12124607 |
gaggttcgaaccccggaccttgcatatattatgcattgtccttaccaactgagc |
12124554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 28572189 - 28572107
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||||||| ||| |||||| | ||| |||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
28572189 |
ttgtattgaaaagtgaaatgactcagttattttgggacactttttatttgcaaatgtctcagttattgtgggacggagggagt |
28572107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 50 - 87
Target Start/End: Original strand, 30757741 - 30757778
Alignment:
| Q |
50 |
ttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30757741 |
ttttgcaaatggctcagttattatgggacggagggagt |
30757778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 109 - 183
Target Start/End: Complemental strand, 34977274 - 34977198
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggac |
183 |
Q |
| |
|
||||||||| ||||| ||| | |||||||||||||||||||||| ||| ||||||||||| ||||||||||||| |
|
|
| T |
34977274 |
tggtggccggggtttaaactccggaccttgcatatattatgcattgtccataccaactgagttaagctcacgaggac |
34977198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 119 - 152
Target Start/End: Complemental strand, 37852070 - 37852037
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
37852070 |
ggtttgaaccctggaccttgcatatattatgcat |
37852037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 38282550 - 38282632
Alignment:
| Q |
1 |
aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagg |
83 |
Q |
| |
|
||||||||||| |||||||| |||| |||| |||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
38282550 |
aatgttgtattaaaaagtgagatgaatcaagattcttgggacaatatttttttataaatggttcagttattatgggacggagg |
38282632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 111 - 152
Target Start/End: Complemental strand, 42791363 - 42791322
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
42791363 |
gtggccggggtttgaaccccggaccttgcatatattatgcat |
42791322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 3100335 - 3100295
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
3100335 |
tttttttgcaaatggctcagttattgtgggacggagggagt |
3100295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 4509608 - 4509564
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||| ||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
4509608 |
gtggtggctgagatttgaaccttggaccttgcatatattatgcat |
4509564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 18460470 - 18460393
Alignment:
| Q |
1 |
aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggac |
78 |
Q |
| |
|
||||||||| ||||||| ||||| |||||| ||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
18460470 |
aatgttgtagtgaaaagagaaattagtcaagattcttgggacaatattttttaacaaatgactcagttattttgggac |
18460393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 185
Target Start/End: Original strand, 20017046 - 20017125
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacag |
185 |
Q |
| |
|
|||||||||||| ||||||| | ||||||||||||||| ||||| ||| ||||| |||||| ||||||||||||||| |
|
|
| T |
20017046 |
gtggtggccgagatttgaactccggaccttgcatatataatgcaatgtccttaccagctgagctaagctcacgaggacag |
20017125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 152
Target Start/End: Original strand, 24579670 - 24579702
Alignment:
| Q |
120 |
gtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
24579670 |
gtttgaaccctggaccttgcatatattatgcat |
24579702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 148
Target Start/End: Complemental strand, 31813049 - 31813009
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattat |
148 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
31813049 |
gtggtggccgatgtttgaaccttggaccttgcatatattat |
31813009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 152
Target Start/End: Complemental strand, 32458361 - 32458329
Alignment:
| Q |
120 |
gtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
32458361 |
gtttgaaccctggaccttgcatatattatgcat |
32458329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 40710509 - 40710469
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40710509 |
ttttgttgcaaatgactcatttattatgggacggagggagt |
40710469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 109 - 169
Target Start/End: Complemental strand, 41859922 - 41859862
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
41859922 |
tggtggccggggtttgaaccccagaccttgcatattttatgcattgtccataccaactgag |
41859862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 119 - 170
Target Start/End: Original strand, 8781651 - 8781702
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||| ||| |||||||||||| |
|
|
| T |
8781651 |
ggtttgaaccccggaccttgcatacattatgcattgtccataccaactgagc |
8781702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 10724010 - 10723932
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggaca |
184 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||| | || |||||||||| |||||||||||||| |
|
|
| T |
10724010 |
gtggtggccggggtttgaacctcagaccttgcatatattatgcattacccaaaccaactgagttaagctcacgaggaca |
10723932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 19976225 - 19976162
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcata-tattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||| ||||||| |||||| |||||||||||| |||||||||| ||| |||||||||||| |
|
|
| T |
19976225 |
gtggtggtcgaggttcgaaccccggaccttgcatattattatgcattgtccataccaactgagc |
19976162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 21482509 - 21482587
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||| || |||| ||||| |||||||||||||||||| ||| |||| |||||||||||| | |||||||||||| |
|
|
| T |
21482509 |
gtggtggtcggggttcaaaccccggaccttgcatatattatacattatccttaccaactgagctaaactcacgaggaca |
21482587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 22523002 - 22523080
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| | |||||||| | ||||||||||||||||| || ||| |||||||||||| |||||||||||||| |
|
|
| T |
22523002 |
gtggtggccgggatttgaacctcgaaccttgcatatattatgtattgtccataccaactgagctaagctcacgaggaca |
22523080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 119 - 170
Target Start/End: Complemental strand, 24593436 - 24593385
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
24593436 |
ggttcgaaccccggaccttgcatatattatgcattgtccttaccaactgagc |
24593385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 120 - 180
Target Start/End: Complemental strand, 29599998 - 29599936
Alignment:
| Q |
120 |
gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgag |
180 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||| |||| ||||||||||| |||||||||| |
|
|
| T |
29599998 |
gtttgaaccccggaccttggatatattatgcattatccaaaccaactgagctaagctcacgag |
29599936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 33064057 - 33063979
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| ||| |||| | |||||||||||||||||||||| ||| || ||||||||| |||||||||||||| |
|
|
| T |
33064057 |
gtggtggccggagttcgaactccggaccttgcatatattatgcattgtccatatcaactgagctaagctcacgaggaca |
33063979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 112 - 184
Target Start/End: Original strand, 41763872 - 41763946
Alignment:
| Q |
112 |
tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||| ||||||||||| ||||| |||||||| ||||||| ||| |||||||||||| || ||||||||||| |
|
|
| T |
41763872 |
tggccggggtttgaaccccggaccgtgcatatactatgcattgtccataccaactgagctaagttcacgaggaca |
41763946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 45032764 - 45032686
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggaca |
184 |
Q |
| |
|
|||||||| ||||||||| || || |||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
45032764 |
gtggtggctgaggtttgagcctcagatcttgcatatattatgcattgtccctaccaactgaggtaagctcacgaggaca |
45032686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 112 - 170
Target Start/End: Original strand, 833063 - 833121
Alignment:
| Q |
112 |
tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||| || ||||| ||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
833063 |
tggccgaggattaaaccccagaccttgcatatattatgcattgtccataccaactgagc |
833121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 169
Target Start/End: Complemental strand, 961163 - 961113
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
961163 |
ggtttgaatcatggaccttgcatatattatgcattgtccctaccaattgag |
961113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 133 - 184
Target Start/End: Original strand, 3197094 - 3197147
Alignment:
| Q |
133 |
accttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| | |||||||||||| |
|
|
| T |
3197094 |
accttgcatatattatgcattgtccctaccaactgagctaaactcacgaggaca |
3197147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 3708764 - 3708688
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||||||| |||||||| | |||||||||| ||| ||||||||||||| |
|
|
| T |
3708764 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac |
3708688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 111 - 169
Target Start/End: Original strand, 8091151 - 8091209
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||| ||| |||||||||| |||||||||||||||||||||| ||| |||| |||||| |
|
|
| T |
8091151 |
gtggtcgatgtttgaaccccggaccttgcatatattatgcattgtccatacctactgag |
8091209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 11868652 - 11868728
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||||||| |||||||| | |||||||||| ||| ||||||||||||| |
|
|
| T |
11868652 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac |
11868728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 13000756 - 13000694
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||| |||||||||| |||| ||||||| |||||||||||||| ||| |||||||||||| |
|
|
| T |
13000756 |
gtggtagccgaggtttaaacctcggaccttacatatattatgcattatctttaccaactgagc |
13000694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 20120711 - 20120773
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||| ||| | ||||||||| | |||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
20120711 |
gtggtgtccgggatttgaaccccgaaccttgcatatattatgcattgtccttaccaactgagc |
20120773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 30045524 - 30045462
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||||||||||||| | | |||||| ||||||||||||| |||||||||| ||||| |
|
|
| T |
30045524 |
gtggtggccgaggtttgaatctcgaaccttgtatatattatgcattgtccctaccaattgagc |
30045462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 30050687 - 30050625
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||||||||||||| | | |||||| ||||||||||||| |||||||||| ||||| |
|
|
| T |
30050687 |
gtggtggccgaggtttgaatctcgaaccttgtatatattatgcattgtccctaccaattgagc |
30050625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 30141731 - 30141669
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||||||||||||| | | |||||| ||||||||||||| |||||||||| ||||| |
|
|
| T |
30141731 |
gtggtggccgaggtttgaatctcgaaccttgtatatattatgcattgtccctaccaattgagc |
30141669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 35360045 - 35360121
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||||||| |||||||| | |||||||||| ||| ||||||||||||| |
|
|
| T |
35360045 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac |
35360121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 124 - 170
Target Start/End: Original strand, 35685067 - 35685113
Alignment:
| Q |
124 |
gaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
35685067 |
gaaccctagaccttgcatatattatgcattgtccttaccaactgagc |
35685113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 36474833 - 36474771
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||| |||||||| |||||| ||||||||| |
|
|
| T |
36474833 |
gtggtggccggaatttgaaccccggaccttgcatattttatgcattgtccctatcaactgagc |
36474771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 42778688 - 42778629
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||||||||||||||| || |||||||| |||||||||||| ||| ||||||||||| |
|
|
| T |
42778688 |
gtggtggccgaggtttgaatcccggaccttg--tatattatgcattgtccttaccaactgag |
42778629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 109 - 170
Target Start/End: Complemental strand, 3617162 - 3617101
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||| ||||||||||||||| |||| |||||||||||| ||| |||||| ||||| |
|
|
| T |
3617162 |
tggtggccggagtttgaaccctggactttgcgtatattatgcattgtccttaccaattgagc |
3617101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 119 - 164
Target Start/End: Complemental strand, 4180757 - 4180712
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaa |
164 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||| ||||| ||||| |
|
|
| T |
4180757 |
ggtttgaaccccggaccttgcatattttatgcattatcccaaccaa |
4180712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 4897614 - 4897553
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||||| |||||||||| | |||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
4897614 |
gtggtggccagggtttgaaccataaaccttgcatatattatgcattgtccttaccaactgag |
4897553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 4945008 - 4944947
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||||| |||||||||| | |||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
4945008 |
gtggtggccagggtttgaaccataaaccttgcatatattatgcattgtccttaccaactgag |
4944947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 124 - 169
Target Start/End: Complemental strand, 6141275 - 6141230
Alignment:
| Q |
124 |
gaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
6141275 |
gaaccctagaccttgcatatattatgcattgtccttaccaactgag |
6141230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 116 - 169
Target Start/End: Original strand, 6723075 - 6723128
Alignment:
| Q |
116 |
cgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||| ||| || |||||||| |
|
|
| T |
6723075 |
cgaggttcgaaccctggaccttgcatatattatacattgtccatatcaactgag |
6723128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 121 - 170
Target Start/End: Complemental strand, 7350604 - 7350555
Alignment:
| Q |
121 |
tttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||| ||| |||||||||||| |
|
|
| T |
7350604 |
tttgaaccctagactttgcatatattatgcattgtccataccaactgagc |
7350555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 153
Target Start/End: Complemental strand, 8728890 - 8728845
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatc |
153 |
Q |
| |
|
||||||| || ||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
8728890 |
gtggtggtcggggtttgaaccctggatcttgcatattttatgcatc |
8728845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 133 - 183
Target Start/End: Original strand, 9383224 - 9383276
Alignment:
| Q |
133 |
accttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
9383224 |
accttgcatatattatgcattgtccataccaactgagctaagctcacgaggac |
9383276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 133 - 183
Target Start/End: Original strand, 9842217 - 9842269
Alignment:
| Q |
133 |
accttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
9842217 |
accttgcatattttatgcattgtccctaccaactgagctaagctcacgaggac |
9842269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 117 - 170
Target Start/End: Complemental strand, 12124746 - 12124693
Alignment:
| Q |
117 |
gaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||| |||| | |||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
12124746 |
gaggttcgaactccggaccttgcatatattatgcattgtccttaccaactgagc |
12124693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 129 - 170
Target Start/End: Complemental strand, 12231927 - 12231886
Alignment:
| Q |
129 |
ctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||| |||| |
|
|
| T |
12231927 |
ctggaccttgcatatattatgcattatccttaccaacagagc |
12231886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 124 - 169
Target Start/End: Complemental strand, 14364109 - 14364064
Alignment:
| Q |
124 |
gaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
14364109 |
gaaccctggaccttacatatattatgcattgtccataccaactgag |
14364064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 109 - 183
Target Start/End: Original strand, 14463737 - 14463812
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggac |
183 |
Q |
| |
|
||||| ||| |||||||||| ||||| ||| ||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
14463737 |
tggtgtccggggtttgaacc-tggactttggatatattatgcattttccctaccaactgaggtaagctcacgaggac |
14463812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 5 - 87
Target Start/End: Original strand, 18181343 - 18181425
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||| | |||| |||||||||||||||||||||||||| |
|
|
| T |
18181343 |
ttgtattgaaaagtgaaatgggtcagttattttaggacaatatttttctacaaaaagctcagttattatgggacggagggagt |
18181425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 119 - 152
Target Start/End: Original strand, 18693663 - 18693696
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
18693663 |
ggtttgaaccctggatcttgcatatattatgcat |
18693696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 111 - 152
Target Start/End: Complemental strand, 22709153 - 22709112
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||| |||||||| |
|
|
| T |
22709153 |
gtggccggggtttgaaccccggaccttgcatattttatgcat |
22709112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 25395432 - 25395493
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||| || | |||||||| || |||||||||||||||||||| | ||||||||||||| |
|
|
| T |
25395432 |
gtggtggtcgggatttgaaccttgaaccttgcatatattatgcattgttcctaccaactgag |
25395493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 28844039 - 28843957
Alignment:
| Q |
1 |
aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagg |
83 |
Q |
| |
|
|||||||||||||||| ||||||| |||| ||||||||||||||| ||||||||||| |||||| |||| ||||| |
|
|
| T |
28844039 |
aatgttgtattgaaaactgaaatggatcaaaattcttaggacaatatttttttacaaatgactcaattattacgggagggagg |
28843957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 29809397 - 29809336
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||| | || |||||| | ||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
29809397 |
gtggtggccgggattcgaaccccgtacctttcatatattatgcattgtccctaccaactgag |
29809336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 149
Target Start/End: Original strand, 29872162 - 29872203
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatg |
149 |
Q |
| |
|
||||||| ||||||||||||| | |||||||||||||||||| |
|
|
| T |
29872162 |
gtggtggtcgaggtttgaaccttagaccttgcatatattatg |
29872203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 43 - 80
Target Start/End: Original strand, 29938101 - 29938138
Alignment:
| Q |
43 |
aatatttttttgcaaatgactcagttattatgggacgg |
80 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
29938101 |
aatatttttttgcaaatgactaagttattatggaacgg |
29938138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 111 - 184
Target Start/End: Original strand, 32063580 - 32063656
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatatt-atgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||| ||||||||||||| |||||||||||| || |||||| |||| |||||||||||| |||||||||||||| |
|
|
| T |
32063580 |
gtggtcgaggtttgaacctctgaccttgcatatttttatgcattatccataccaactgagctaagctcacgaggaca |
32063656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 119 - 152
Target Start/End: Complemental strand, 38904121 - 38904088
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
38904121 |
ggtttgaaccctgaaccttgcatatattatgcat |
38904088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 149
Target Start/End: Complemental strand, 44810776 - 44810735
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatg |
149 |
Q |
| |
|
|||||||| | ||||||||||| ||||||||||||||||||| |
|
|
| T |
44810776 |
gtggtggctggggtttgaaccccggaccttgcatatattatg |
44810735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 170
Target Start/End: Complemental strand, 1844889 - 1844829
Alignment:
| Q |
110 |
ggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||| |||||||| |||||| || || |||||||| |||||| ||||||||||||||||| |
|
|
| T |
1844889 |
ggtgtccgaggttcgaaccccggcccctgcatataatatgcaatatccctaccaactgagc |
1844829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 7052845 - 7052766
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcata-tattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||| ||| ||||||| ||| |||||||||||| |||||||||| ||| |||||||||||| |||||||| ||||| |
|
|
| T |
7052845 |
gtggtgtccggggtttgagccccggaccttgcatattattatgcattgtccttaccaactgagctaagctcacggggaca |
7052766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 41 - 85
Target Start/End: Complemental strand, 12872942 - 12872898
Alignment:
| Q |
41 |
acaatatttttttgcaaatgactcagttattatgggacggaggga |
85 |
Q |
| |
|
|||||||||| ||||||| ||||||||||| ||||||||||||| |
|
|
| T |
12872942 |
acaatattttattgcaaaaaactcagttattttgggacggaggga |
12872898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 15447704 - 15447748
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||||||||||||||| |
|
|
| T |
15447704 |
gtggtggccggggtttgaactccagaccttgcatatattatgcat |
15447748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 16390674 - 16390630
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||||| |||| |||||| ||||||||||||| |||||||| |
|
|
| T |
16390674 |
gtggtggccggggttcgaaccccggaccttgcatattttatgcat |
16390630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 20990894 - 20990938
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||| || ||||||||||||| ||||||||||| |||||||| |
|
|
| T |
20990894 |
gtggtggtcggggtttgaaccctgaaccttgcatattttatgcat |
20990938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 21497738 - 21497694
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||||||||||| |||| | |||||||||||||||||||| |
|
|
| T |
21497738 |
gtggtggccgaggtttaaacctcgaaccttgcatatattatgcat |
21497694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 22571855 - 22571899
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||| ||| ||||||||| |||| ||||||||||||||||| |
|
|
| T |
22571855 |
gtggtggctgagatttgaaccccggacattgcatatattatgcat |
22571899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 168
Target Start/End: Complemental strand, 26999181 - 26999121
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga |
168 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||| || ||||||||||| |
|
|
| T |
26999181 |
gtggtggccggagtttgaaccgcagaccttgcatatattatgcattgtctctaccaactga |
26999121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 32204615 - 32204571
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||||||||||| ||| | |||| |||||||||||||||||| |
|
|
| T |
32204615 |
gtggtggccgaggttcgaatcttggatcttgcatatattatgcat |
32204571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 164
Target Start/End: Original strand, 36264469 - 36264525
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaa |
164 |
Q |
| |
|
||||||| || ||||||||||| | || ||||||||||||||||| |||| |||||| |
|
|
| T |
36264469 |
gtggtggtcggggtttgaaccccgaactttgcatatattatgcattatccataccaa |
36264525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 182
Target Start/End: Original strand, 41939123 - 41939174
Alignment:
| Q |
133 |
accttgcatatattatgcatcatccctaccaactgagc--agctcacgagga |
182 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||| ||| |||||||||||| |
|
|
| T |
41939123 |
accttacatatattatgcattatccctaccaactaagctaagctcacgagga |
41939174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 77
Target Start/End: Original strand, 43427492 - 43427565
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaata-tttttttgcaaatgactcagttattatggga |
77 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||| ||||||||||||| ||| | ||||||||||| |
|
|
| T |
43427492 |
ttgtattgaaaagtgaaatgagtcaattttactgggataatattttttttgcaaataacttaattattatggga |
43427565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 44534657 - 44534697
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||| ||||| |
|
|
| T |
44534657 |
tttttttgtaaatgactcagttattgtgggacggatggagt |
44534697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 54; Significance: 4e-22; HSPs: 102)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 37496522 - 37496608
Alignment:
| Q |
1 |
aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37496522 |
aatgttgtgttgaaaagtgaaatgggtcaatttttttgggataatatttttttgcaaatgactcagttattatgggacggagggagt |
37496608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 3 - 87
Target Start/End: Complemental strand, 34064195 - 34064111
Alignment:
| Q |
3 |
tgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||| |||||| ||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34064195 |
tgttgtattaaaaagtaaaatgagtcaattttttcgggacaatatttttttgcaaatgactaagttattatgggacggagggagt |
34064111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 32775960 - 32775878
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||| ||||||||||| ||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32775960 |
ttgtattggaaagtgaaatgggtcaatttttttgggacaatatttttttgcaaatgcctcagttattatgggacggagggagt |
32775878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 21322246 - 21322185
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||||||||| |||| ||||||||||| |
|
|
| T |
21322246 |
gtggtggccggggtttgaaccctggaccttgcatacattatgcattatccttaccaactgag |
21322185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 19416585 - 19416507
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||| |||||||| ||| |||||||||||| |||||||||||||| |
|
|
| T |
19416585 |
gtggtggccggggtttgaaccccggaccttgcatattttatgcattgtccataccaactgagctaagctcacgaggaca |
19416507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 27462426 - 27462504
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
27462426 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagctatgctcacgaggaca |
27462504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 3830139 - 3830077
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
3830139 |
gtggtggctggggtttgaaccctggaccttgcatatattatgcattgtccctacaaactgagc |
3830077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 10244797 - 10244721
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
10244797 |
gtggtggccg-ggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagctaagctcacgaggac |
10244721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 16537526 - 16537588
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||| ||||||||||||||| ||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
16537526 |
gtggtgaccgaggtttgaaccccagaccttgtatatattatgcattatccctaccaactgagc |
16537588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 16577850 - 16577912
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| || |||||||||||||||| |
|
|
| T |
16577850 |
gtggtggccgaggtttgaaccccagaccttgcatatattatgtattgtccctaccaactgagc |
16577912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 16587812 - 16587750
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| || |||||||||||||||| |
|
|
| T |
16587812 |
gtggtggccgaggtttgaaccccagaccttgcatatattatgtattgtccctaccaactgagc |
16587750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 16628136 - 16628074
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||| ||||||||||||||| ||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
16628136 |
gtggtgaccgaggtttgaaccccagaccttgtatatattatgcattatccctaccaactgagc |
16628074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 5 - 87
Target Start/End: Original strand, 5068427 - 5068509
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||| ||||| ||||||||||| ||||||||||||| ||||||| |
|
|
| T |
5068427 |
ttgtattaaaaagtgaaatgagtcaatattcttgggacaatatatttttacaaatgactcacttattatgggacgaagggagt |
5068509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 39 - 87
Target Start/End: Complemental strand, 32346457 - 32346409
Alignment:
| Q |
39 |
ggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32346457 |
ggacaatatttttatgcaaatgactcacttattatgggacggagggagt |
32346409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 3 - 87
Target Start/End: Original strand, 3668004 - 3668088
Alignment:
| Q |
3 |
tgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||| |||||||||||||||||| || ||||| ||||| |
|
|
| T |
3668004 |
tgttgtattgaaaagtgaaatgggtcaatttttttaggacaatatttttttacaaatgactcagttattacggaacggatggagt |
3668088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 166
Target Start/End: Original strand, 21554924 - 21554982
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaact |
166 |
Q |
| |
|
||||||| || |||||||| |||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
21554924 |
gtggtggtcggggtttgaatcctggaccttgcatatattaagcattatccctaccaact |
21554982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 47607900 - 47607962
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
47607900 |
gtggtggccggagtttgaaccctggaccttgcatatattatgtaatgtccctaccaactgagc |
47607962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 2846801 - 2846887
Alignment:
| Q |
1 |
aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||| |||||||||||||||||||| ||| |||||| | |||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2846801 |
aatgatgtattgaaaagtgaaatgactcacttattttgggacacttttttattgaaaatgactcagttattatgggacggagggagt |
2846887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 38 - 87
Target Start/End: Complemental strand, 18731387 - 18731338
Alignment:
| Q |
38 |
gggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| |||||||||||||||| |
|
|
| T |
18731387 |
gggacaatatttttttacaaacgactcagttatcatgggacggagggagt |
18731338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 38 - 83
Target Start/End: Complemental strand, 47238163 - 47238118
Alignment:
| Q |
38 |
gggacaatatttttttgcaaatgactcagttattatgggacggagg |
83 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
47238163 |
gggacaatatttttttgcaaatggctcaattattatgggacggagg |
47238118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 30462952 - 30462912
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30462952 |
tttttttgcaaatgactcaattattatgggacggagggagt |
30462912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 31581620 - 31581660
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31581620 |
tttttttgcaaatgactcagttattatgggacggagagagt |
31581660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 5579764 - 5579686
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||| || ||||||||||| |||||||||||||||||||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
5579764 |
gtggtggtcggggtttgaaccccagaccttgcatatattatgcactgtccctaccaactgagctaagctcacaaggaca |
5579686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 109 - 152
Target Start/End: Complemental strand, 10327023 - 10326981
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10327023 |
tggtggccgaggtttgaacc-tggaccttgcatatattatgcat |
10326981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 119 - 170
Target Start/End: Complemental strand, 18714508 - 18714457
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
18714508 |
ggtttgaaccccggaccttgcatatattatgcattgtccttaccaactgagc |
18714457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 110 - 169
Target Start/End: Complemental strand, 19599214 - 19599155
Alignment:
| Q |
110 |
ggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||| || ||||||||||| |||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
19599214 |
ggtggtcggggtttgaaccccggaccttgcatatattatgcattgtccataccaactgag |
19599155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 115 - 170
Target Start/End: Original strand, 29237554 - 29237609
Alignment:
| Q |
115 |
ccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| | | |||||||||||| |
|
|
| T |
29237554 |
ccgaggttcgaaccctggaccttgcatatattatgcattgttcttaccaactgagc |
29237609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 31038512 - 31038590
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||| | ||||||| ||| |||||||||||| |||||||||||||| |
|
|
| T |
31038512 |
gtggtggccggggtttgaaccccagaccttgcatacaatatgcattgtccataccaactgagctaagctcacgaggaca |
31038590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 109 - 152
Target Start/End: Original strand, 42095934 - 42095977
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42095934 |
tggtggcagaggtttgaaccccggaccttgcatatattatgcat |
42095977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 42829224 - 42829302
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggaca |
184 |
Q |
| |
|
|||||||||| |||||||||| ||| |||||||||||||||||| |||||| |||||||| |||||||||||||| |
|
|
| T |
42829224 |
gtggtggccggagtttgaaccccggagcttgcatatattatgcattgtccctatcaactgagtcaagctcacgaggaca |
42829302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 14046601 - 14046678
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggac |
183 |
Q |
| |
|
|||||||||| ||||||||||| | | |||||||||||||||||| | || ||||||||||| ||||||||||||| |
|
|
| T |
14046601 |
gtggtggccggggtttgaaccccgtatcttgcatatattatgcattacccataccaactgagataagctcacgaggac |
14046678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 14356631 - 14356708
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggac |
183 |
Q |
| |
|
|||||||||| ||||||||||| | | |||||||||||||||||| | || ||||||||||| ||||||||||||| |
|
|
| T |
14356631 |
gtggtggccggggtttgaaccccgtatcttgcatatattatgcattacccataccaactgagataagctcacgaggac |
14356708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 5 - 83
Target Start/End: Complemental strand, 25778715 - 25778636
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatattttttt-gcaaatgactcagttattatgggacggagg |
83 |
Q |
| |
|
||||||||||||||||||| |||||| | |||||||||||||| | ||||||| |||||||||||||||||||| |
|
|
| T |
25778715 |
ttgtattgaaaagtgaaataagtcaatttttttgagacaatattttttttgaaaatgacccagttattatgggacggagg |
25778636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 27833391 - 27833453
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||| || ||||||||||| ||||||| |||||||||||||| ||| |||||||||||| |
|
|
| T |
27833391 |
gtggtggtcggggtttgaaccccggaccttacatatattatgcattgtccttaccaactgagc |
27833453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 46987157 - 46987095
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||| ||| |||| |||||| |||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
46987157 |
gtggtgtccggggttcgaaccccggaccttgcatatattatgcattgtccttaccaactgagc |
46987095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 111 - 152
Target Start/End: Complemental strand, 7670502 - 7670461
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7670502 |
gtggtcgaggtttgaaccccggaccttgcatatattatgcat |
7670461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 119 - 152
Target Start/End: Complemental strand, 10242540 - 10242507
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
10242540 |
ggtttgaaccctggaccttgcatatattatgcat |
10242507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 120 - 161
Target Start/End: Complemental strand, 18023738 - 18023697
Alignment:
| Q |
120 |
gtttgaaccctggaccttgcatatattatgcatcatccctac |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18023738 |
gtttgaaccctggaccttgcatatattatgcattgtccctac |
18023697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 113 - 170
Target Start/End: Original strand, 38374186 - 38374243
Alignment:
| Q |
113 |
ggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||| ||| |||||| ||||| |
|
|
| T |
38374186 |
ggccggggtttgaaccctggaccttgcatatactatgcattgtccataccaattgagc |
38374243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 108 - 161
Target Start/End: Original strand, 47155094 - 47155147
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctac |
161 |
Q |
| |
|
|||||| ||| |||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47155094 |
gtggtgtccggggttcgaaccctggaccttgcatatattatgcattgtccctac |
47155147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 7426048 - 7426088
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
7426048 |
tttttttgcaaatggctcagttattgtgggacggagggagt |
7426088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 11616491 - 11616451
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
11616491 |
tttttttgcaaatggctcagttattatgggatggagggagt |
11616451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 168
Target Start/End: Complemental strand, 12212344 - 12212285
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga |
168 |
Q |
| |
|
|||||| |||||||| |||||||| |||||||||||||||| |||| ||| |||||||||| |
|
|
| T |
12212344 |
gtggtgtccgaggttcgaaccctg-accttgcatatattatacatcgtccttaccaactga |
12212285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 111 - 184
Target Start/End: Original strand, 19626518 - 19626593
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggaca |
184 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||||||| ||| |||||||||| |||||||||||||| |
|
|
| T |
19626518 |
gtggccggtgtttgaaccccggaccttgcatatattatgcattgtccaaaccaactgagttaagctcacgaggaca |
19626593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 39 - 87
Target Start/End: Original strand, 23111693 - 23111741
Alignment:
| Q |
39 |
ggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||| || |||||||| |
|
|
| T |
23111693 |
ggacaatatttttttgcaaatgacttatttattatggaacagagggagt |
23111741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 152
Target Start/End: Original strand, 26717930 - 26717962
Alignment:
| Q |
120 |
gtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
26717930 |
gtttgaaccctggaccttgcatatattatgcat |
26717962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 33473511 - 33473555
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
33473511 |
gtggtggccagggttggaaccctggaccttgcatatattatgcat |
33473555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 119 - 184
Target Start/End: Original strand, 34448611 - 34448678
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggaca |
184 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||| |||||||||| |||||||||||||| |
|
|
| T |
34448611 |
ggtttgaaccctggaccttacatatattatgcattgtccaaaccaactgagttaagctcacgaggaca |
34448678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 133 - 169
Target Start/End: Original strand, 44941428 - 44941464
Alignment:
| Q |
133 |
accttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44941428 |
accttgcatatattatgcattatccctaccaactgag |
44941464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 111 - 184
Target Start/End: Complemental strand, 46737853 - 46737778
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||||||| ||| || |||||||| |||||||||||||| |
|
|
| T |
46737853 |
gtggccggtgtttgaaccccggaccttgcatatattatgcattgtccaaacaaactgagctaagctcacgaggaca |
46737778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 124 - 184
Target Start/End: Complemental strand, 2618734 - 2618672
Alignment:
| Q |
124 |
gaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||| |||||||||||| |||||||| ||||| |
|
|
| T |
2618734 |
gaaccccggaccttgcatatattatgcattgtccttaccaactgagcgaagctcacggggaca |
2618672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 119 - 183
Target Start/End: Complemental strand, 4047845 - 4047780
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||| || |||| ||||||||| ||||||||||||| |
|
|
| T |
4047845 |
ggtttaaaccctgaaccttgcatatattatgcattat-cctatcaactgagctaagctcacgaggac |
4047780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 136 - 184
Target Start/End: Complemental strand, 5833085 - 5833035
Alignment:
| Q |
136 |
ttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||| ||||| |
|
|
| T |
5833085 |
ttgcatatattatgcattatccctaccaactgagctaagctcacggggaca |
5833035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 180
Target Start/End: Complemental strand, 21174430 - 21174356
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgag |
180 |
Q |
| |
|
|||||||||| ||||||||||| ||| ||| |||||| ||| ||| |||||||||||||||| |||||||||| |
|
|
| T |
21174430 |
gtggtggccggggtttgaaccccggaactttcatatagtattcattgtccctaccaactgagctaagctcacgag |
21174356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 119 - 166
Target Start/End: Original strand, 24824413 - 24824460
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaact |
166 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||| |||| |||||||| |
|
|
| T |
24824413 |
ggtttgaaccatggaccttgcatattttatgcattatccataccaact |
24824460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 131 - 170
Target Start/End: Complemental strand, 25888948 - 25888909
Alignment:
| Q |
131 |
ggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
25888948 |
ggaccttgcatatattatgcatcgtccttaccaactgagc |
25888909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 136 - 184
Target Start/End: Original strand, 26816682 - 26816732
Alignment:
| Q |
136 |
ttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||| ||||| |
|
|
| T |
26816682 |
ttgcatatattatgcattatccctaccaactgagctaagctcacggggaca |
26816732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 116 - 184
Target Start/End: Original strand, 27993027 - 27993097
Alignment:
| Q |
116 |
cgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggaca |
184 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||| | | ||||||||||| |||||||||||||| |
|
|
| T |
27993027 |
cgaggtttgaaccctagaccttgcatattttatgcattgttcataccaactgagttaagctcacgaggaca |
27993097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 37624614 - 37624536
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggaca |
184 |
Q |
| |
|
|||||||||| | || |||||| ||||||||||||||||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
37624614 |
gtggtggccgggattcgaacccccgaccttgcatatattatgcattgtccataccaactgaggaaagctcacgaggaca |
37624536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 38088007 - 38088085
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||| |||||||||||||| | || |||||||||||||||| | ||| |||||||||||| |||||||||||||| |
|
|
| T |
38088007 |
gtggttgccgaggtttgaactcaggtccttgcatatattatgttttgtccttaccaactgagctaagctcacgaggaca |
38088085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 40 - 87
Target Start/End: Complemental strand, 39498617 - 39498570
Alignment:
| Q |
40 |
gacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||| |||| | |||||||||||||| ||||||||||| |
|
|
| T |
39498617 |
gacaatatttttttacaaaaggctcagttattatggaacggagggagt |
39498570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 109 - 168
Target Start/End: Original strand, 48629056 - 48629115
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga |
168 |
Q |
| |
|
|||||| || ||||| ||||| |||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
48629056 |
tggtggtcggggtttaaaccccggaccttgcatatattatgcattgtccctaacaactga |
48629115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 87
Target Start/End: Original strand, 5724882 - 5724920
Alignment:
| Q |
49 |
tttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
5724882 |
tttttgtaaatgactcagttattatggaacggagggagt |
5724920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 47 - 81
Target Start/End: Original strand, 6838602 - 6838636
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacgga |
81 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6838602 |
tttttttgcaaatgactcacttattatgggacgga |
6838636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 20763225 - 20763149
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||||||| |||||||| | |||||||||| ||| ||||||||||||| |
|
|
| T |
20763225 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac |
20763149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 112 - 170
Target Start/End: Complemental strand, 24657037 - 24656979
Alignment:
| Q |
112 |
tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||| |||||| |||| ||||||||| ||||| |||||||| |||| |||||||||||| |
|
|
| T |
24657037 |
tggctgaggttcgaactctggaccttacatattttatgcattatccataccaactgagc |
24656979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 29488791 - 29488715
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||||||| |||||||| | |||||||||| ||| ||||||||||||| |
|
|
| T |
29488791 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac |
29488715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 33232387 - 33232463
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||||||| |||||||| | |||||||||| ||| ||||||||||||| |
|
|
| T |
33232387 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac |
33232463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 34284529 - 34284605
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||||||| |||||||| | |||||||||| ||| ||||||||||||| |
|
|
| T |
34284529 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac |
34284605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 120 - 170
Target Start/End: Original strand, 39280820 - 39280870
Alignment:
| Q |
120 |
gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| | | |||||||||||| |
|
|
| T |
39280820 |
gtttgaaccccggaccttgcatatattatgcattgttcttaccaactgagc |
39280870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 135 - 169
Target Start/End: Original strand, 39458561 - 39458595
Alignment:
| Q |
135 |
cttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
39458561 |
cttgcatatattatgcattatccctaccaactgag |
39458595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 109 - 184
Target Start/End: Original strand, 40752830 - 40752907
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||||| |||| |||||| |||| |||||||||||||| || ||| ||| |||||||| |||||||||||||| |
|
|
| T |
40752830 |
tggtggccggggttcgaaccccggacattgcatatattatgtattgtccatactaactgagctaagctcacgaggaca |
40752907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 120 - 170
Target Start/End: Original strand, 42753529 - 42753579
Alignment:
| Q |
120 |
gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
42753529 |
gtttgaaccccggaccttgcatatattatgcactgtcccttccaactgagc |
42753579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 112 - 170
Target Start/End: Original strand, 43579047 - 43579105
Alignment:
| Q |
112 |
tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||| |||| |||||| |||| |||||| |||||||||| |||||||||||||||| |
|
|
| T |
43579047 |
tggccggggttcgaacccaggactttgcatgtattatgcattgtccctaccaactgagc |
43579105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 111 - 152
Target Start/End: Original strand, 1079685 - 1079726
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||| |||||||| |
|
|
| T |
1079685 |
gtggccgagatttgaaccccggaccttgcatattttatgcat |
1079726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 182
Target Start/End: Complemental strand, 3953510 - 3953436
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgagga |
182 |
Q |
| |
|
||||||||| |||||||||||| | |||||||||||||||||||| ||| |||| ||||||| |||||||||||| |
|
|
| T |
3953510 |
gtggtggcc-aggtttgaaccc-gaaccttgcatatattatgcattgtccataccgactgagctaagctcacgagga |
3953436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 145
Target Start/End: Complemental strand, 5804832 - 5804795
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatat |
145 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
5804832 |
gtggtggccggggttcgaaccctggaccttgcatatat |
5804795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 119 - 152
Target Start/End: Complemental strand, 6781867 - 6781834
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
6781867 |
ggtttgaaccctggaccttgcatattttatgcat |
6781834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 109 - 170
Target Start/End: Complemental strand, 18684199 - 18684139
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||| || ||||||||||| |||||||||||| ||||||||| |||| || ||||||||| |
|
|
| T |
18684199 |
tggtggtcggggtttgaaccc-ggaccttgcatacattatgcattatccatatcaactgagc |
18684139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 111 - 152
Target Start/End: Original strand, 19988688 - 19988729
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
19988688 |
gtggccgaggtttaaaccacggaccttgcatatattatgcat |
19988729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 119 - 152
Target Start/End: Original strand, 20085760 - 20085793
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
20085760 |
ggtttgaaccccggaccttgcatatattatgcat |
20085793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 185
Target Start/End: Complemental strand, 20243327 - 20243247
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatat-attatgcatcatccctaccaactgagc--agctcacgaggacag |
185 |
Q |
| |
|
|||||| ||| |||| ||||| ||||||||||||| ||||||||| ||| |||||||||||| ||||||||||||||| |
|
|
| T |
20243327 |
gtggtgtccggggttcaaaccccggaccttgcatattattatgcattgtccataccaactgagctaagctcacgaggacag |
20243247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 38 - 87
Target Start/End: Original strand, 26938601 - 26938650
Alignment:
| Q |
38 |
gggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||| | ||| |||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
26938601 |
gggacactttttatttgcaaatgactcagctattgtgggacggagggagt |
26938650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 5 - 87
Target Start/End: Original strand, 33774170 - 33774252
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||||||| ||| || ||| | |||||||| |||||||||||||||| || |||||||||||| |
|
|
| T |
33774170 |
ttgtattgaaaagtgaaatgactcagttattttggaacactttttttttgtaaatgactcagttattgtgagacggagggagt |
33774252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 112 - 165
Target Start/End: Original strand, 36033458 - 36033511
Alignment:
| Q |
112 |
tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaac |
165 |
Q |
| |
|
|||||||| ||||||||| | |||||||||||||||| ||| || ||||||||| |
|
|
| T |
36033458 |
tggccgagatttgaaccccgaaccttgcatatattatacattattcctaccaac |
36033511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 111 - 152
Target Start/End: Complemental strand, 36121720 - 36121679
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||| |||||||| |
|
|
| T |
36121720 |
gtggccggggtttgaaccccggaccttgcatattttatgcat |
36121679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 149
Target Start/End: Original strand, 42219377 - 42219418
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatg |
149 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
42219377 |
gtggtggccgatgtttgaacctcggaccttgcatatattatg |
42219418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 124 - 152
Target Start/End: Complemental strand, 2648327 - 2648299
Alignment:
| Q |
124 |
gaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2648327 |
gaaccctggaccttgcatatattatgcat |
2648299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 8084498 - 8084454
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||||| |||| |||||| ||||||||||||| |||||||| |
|
|
| T |
8084498 |
gtggtggccggggttcgaaccccggaccttgcatattttatgcat |
8084454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 9658774 - 9658734
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||| ||||| |
|
|
| T |
9658774 |
tttttttgcaaatgactcagttgttataggacggatggagt |
9658734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 12308316 - 12308276
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||| |||||||||| |||||| ||||||||||||||| |
|
|
| T |
12308316 |
ttttttttcaaatgactcggttattgtgggacggagggagt |
12308276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 16198454 - 16198410
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||||||| || |||| | |||||||||||||||||||||| |
|
|
| T |
16198454 |
gtggtggccgagattcgaactccggaccttgcatatattatgcat |
16198410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 180
Target Start/End: Original strand, 18505659 - 18505721
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgag |
180 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||| |||||||||||||||| |||||||||| |
|
|
| T |
18505659 |
ggtttgaaccc-ggatcttgcatattttatgcattgtccctaccaactgagctaagctcacgag |
18505721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 132 - 168
Target Start/End: Complemental strand, 25923438 - 25923402
Alignment:
| Q |
132 |
gaccttgcatatattatgcatcatccctaccaactga |
168 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
25923438 |
gaccttgcatatattatgcattatccctactaactga |
25923402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 109 - 169
Target Start/End: Complemental strand, 27270305 - 27270245
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||| |||||| |||| | | |||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
27270305 |
tggtggctgaggttcgaactccgaaccttgcatatattatgcattgtccataccaactgag |
27270245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 109 - 149
Target Start/End: Complemental strand, 29986667 - 29986627
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatg |
149 |
Q |
| |
|
|||||| || ||||||||||||||||||||| ||||||||| |
|
|
| T |
29986667 |
tggtggacggggtttgaaccctggaccttgcgtatattatg |
29986627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 33584498 - 33584458
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||| ||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
33584498 |
ttttattgaaaatgcctcagttattatgggacggagggagt |
33584458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 34963986 - 34964026
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||| ||||| |
|
|
| T |
34963986 |
tttttttacaaatgactcagttattatgagacggatggagt |
34964026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 121 - 169
Target Start/End: Original strand, 37230031 - 37230079
Alignment:
| Q |
121 |
tttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
37230031 |
tttgaaccccagaccttgcatatattatgcattttccttaccaactgag |
37230079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 126 - 183
Target Start/End: Complemental strand, 39801759 - 39801700
Alignment:
| Q |
126 |
accctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||| ||| |||||||||||||||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
39801759 |
accccggatcttgcatatattatgcattgtccataccaactgagctaagctcacgaggac |
39801700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 184
Target Start/End: Original strand, 43539105 - 43539172
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||| | |||| ||||||||| ||||||| |||||| |
|
|
| T |
43539105 |
ggtttgaaccccggaccttacatatattatgcattgttcctatcaactgagctaagctcacaaggaca |
43539172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 46095617 - 46095657
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||| |||| |
|
|
| T |
46095617 |
tttttttgcaaacgacttagttattatgggacggagagagt |
46095657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 122)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 38 - 87
Target Start/End: Complemental strand, 2886116 - 2886067
Alignment:
| Q |
38 |
gggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2886116 |
gggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
2886067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 111 - 184
Target Start/End: Original strand, 41763148 - 41763223
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||| |||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
41763148 |
gtggccggggtttgaaccccggaccttgcatattttatgcattatccctaccaactgagctaagctcacgaggaca |
41763223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 15854078 - 15854140
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
15854078 |
gtggtggccgaggtttgaatcctggatcttgcatatattatgcatcgtccataccaactgagc |
15854140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 34521180 - 34521242
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
34521180 |
gtggtggccgaggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagc |
34521242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 108 - 166
Target Start/End: Original strand, 46149034 - 46149092
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaact |
166 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46149034 |
gtggtggccggggtttgaaccttggaccttgcatataatatgcatcatccctaccaact |
46149092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 5 - 82
Target Start/End: Complemental strand, 29225731 - 29225654
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggag |
82 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
29225731 |
ttgtattgaaaagtgaaatgggtcaatctttttgggacaatatttttttacaaatgactcagttattatggggcggag |
29225654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 5 - 85
Target Start/End: Complemental strand, 26583706 - 26583626
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggaggga |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| | |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26583706 |
ttgtattgaaaagtgaaatgggtcaatttttttgagacaatatttttttgcaaatagctcagttattatgggacggaggga |
26583626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 40 - 87
Target Start/End: Complemental strand, 50333878 - 50333831
Alignment:
| Q |
40 |
gacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
50333878 |
gacaatatttttttgcaaatgactcagttattatgggtcggagggagt |
50333831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 17139507 - 17139584
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
||||||| || ||||||||||| |||||||| ||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
17139507 |
gtggtggtcggggtttgaaccccggaccttgaatatattatgcattgtccctaccaactgagctaagctcacgaggac |
17139584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 5 - 87
Target Start/End: Original strand, 26924399 - 26924480
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
26924399 |
ttgtattgaaaagtgaaatgaatcaatttttctgggacaatatttttta-caaatgactcaattattatgggacggagggagt |
26924480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 108 - 157
Target Start/End: Complemental strand, 34595943 - 34595894
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatcc |
157 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
34595943 |
gtggtggccgaggtttgaaccccggaccttgcatatattatgcattatcc |
34595894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 5 - 79
Target Start/End: Original strand, 37541247 - 37541321
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacg |
79 |
Q |
| |
|
||||||||||||||||||| | |||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37541247 |
ttgtattgaaaagtgaaataaatcaatctttctgagacaatatttttttgcaaatgactcagttattatgggacg |
37541321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 3481632 - 3481553
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgca-tcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||||| | |||||||||||||||| |||||||||||||| |
|
|
| T |
3481632 |
gtggtggccggggtttgaaccccagaccttgcatatattatgcatttgtccctaccaactgagctaagctcacgaggaca |
3481553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 39 - 87
Target Start/End: Original strand, 29225571 - 29225619
Alignment:
| Q |
39 |
ggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
29225571 |
ggacaatatttttttacaaatggctcagttattatgggacggagggagt |
29225619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 119 - 184
Target Start/End: Original strand, 37045147 - 37045214
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| | |||||||||||||| |||||||||||||| |
|
|
| T |
37045147 |
ggttcgaaccctggaccttgcatatattatgcattgttcctaccaactgagctgagctcacgaggaca |
37045214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 1794667 - 1794589
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||| |||||||||||||| ||| |||||||||||||||||| ||| ||| |||||||| |||||||||||||| |
|
|
| T |
1794667 |
gtggtggtcgaggtttgaaccccggatcttgcatatattatgcattgtccatactaactgagctaagctcacgaggaca |
1794589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 5 - 81
Target Start/End: Complemental strand, 5503395 - 5503319
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacgga |
81 |
Q |
| |
|
||||||||||||||||||| |||||| | |||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
5503395 |
ttgtattgaaaagtgaaattagtcaatttttttgagacaatatttttttacaaatgactcagttattatgagacgga |
5503319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 5907870 - 5907792
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||| ||| | |||||||||| |||||||| ||||| |
|
|
| T |
5907870 |
gtggtgtccggggtttgaaccctggaccttgcatatattatgcattgtccttgccaactgagctaagctcacggggaca |
5907792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 7925434 - 7925357
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||||||||||||||| | ||||| |||||||||||||| || ||||||||||||| |||||||||||||| |
|
|
| T |
7925434 |
gtggtggccgaggtttgaaccccgaacctt-catatattatgcattgtctctaccaactgagctaagctcacgaggaca |
7925357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 30678803 - 30678881
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggaca |
184 |
Q |
| |
|
||||||||||| ||||||||| || ||||| |||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
30678803 |
gtggtggccgaagtttgaaccatgaaccttacatatattatgcattgtccctaccaactgagttaagctcacgaggaca |
30678881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 42045362 - 42045440
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||||||||||||||| ||| |||||||||||| |||||||||||||| |
|
|
| T |
42045362 |
gtggtggccggggtttgaactccagaccttgcatatattatgcattgtccataccaactgagctaagctcacgaggaca |
42045440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 45139996 - 45140074
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| ||||| ||| |||||||||||||||||||||||| ||| |||||||||||| |||||||| ||||| |
|
|
| T |
45139996 |
gtggtggccggggtttaaactctggaccttgcatatattatgcattgtccataccaactgagctaagctcacggggaca |
45140074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 39 - 85
Target Start/End: Original strand, 7310706 - 7310752
Alignment:
| Q |
39 |
ggacaatatttttttgcaaatgactcagttattatgggacggaggga |
85 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
7310706 |
ggacaatatttttttgtaaatgactcagttattatggaacggaggga |
7310752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 112 - 183
Target Start/End: Complemental strand, 26755683 - 26755610
Alignment:
| Q |
112 |
tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||| ||| || ||||||||| ||||||||||||| |
|
|
| T |
26755683 |
tggccgaggtttgaaccccggaccttgcatatataatgcattgtccatatcaactgagctaagctcacgaggac |
26755610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 27533314 - 27533237
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
||||||| || ||||||||||| | |||||||||||||||||||| |||||||||||||| | ||||||||||||| |
|
|
| T |
27533314 |
gtggtggtcggggtttgaaccccgaaccttgcatatattatgcattgtccctaccaactgatctaagctcacgaggac |
27533237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 29739408 - 29739346
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||| |||||||| ||| |||||||||||| |
|
|
| T |
29739408 |
gtggtagccgaggtttgaaccccggaccttgcatattttatgcattgtccttaccaactgagc |
29739346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 5 - 87
Target Start/End: Original strand, 29756274 - 29756357
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttt-tttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||| |||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
29756274 |
ttgtattgaaaagtgaaatgggtcaatttttctaggacaatattttttttgcaaatggctctgttattatgggacggagggagt |
29756357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 49431983 - 49432045
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||| ||||||||||| ||||||| |||||||||||||| || ||||||||| |||| |
|
|
| T |
49431983 |
gtggtggccggggtttgaaccccggaccttacatatattatgcattattcctaccaaccgagc |
49432045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 50638906 - 50638968
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||| | || ||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
50638906 |
gtggtggccgggattcgaaccctggaccttgcatatattatgcattgtccttaccaactgagc |
50638968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 114 - 183
Target Start/End: Complemental strand, 25533038 - 25532967
Alignment:
| Q |
114 |
gccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||| ||| |||||||||| | ||||||||||||| |
|
|
| T |
25533038 |
gccggggtttgaaccccggaccttgcatatattatgcattgtccataccaactgaactaagctcacgaggac |
25532967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 108 - 164
Target Start/End: Complemental strand, 41973326 - 41973270
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaa |
164 |
Q |
| |
|
|||||||||| |||| |||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
41973326 |
gtggtggccggggttcgaaccccggaccttgcatatattatgcattgtccctaccaa |
41973270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 110 - 169
Target Start/End: Complemental strand, 12212364 - 12212305
Alignment:
| Q |
110 |
ggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||| || ||||||||||| |||| ||||||||||||||||| ||||||||||| |||| |
|
|
| T |
12212364 |
ggtggtcggggtttgaaccccggacgttgcatatattatgcattatccctaccaaatgag |
12212305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 16033440 - 16033518
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggaca |
184 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||| |||||| |||||||| |||||||||||||| |
|
|
| T |
16033440 |
gtggtggccggagtttgaaccccagaccttgcatatattatgcattgtccctatcaactgagtcaagctcacgaggaca |
16033518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 119 - 170
Target Start/End: Complemental strand, 17284011 - 17283960
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
17284011 |
ggttcgaaccctggaccttgcatatattatgcattgtccttaccaactgagc |
17283960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 119 - 183
Target Start/End: Original strand, 21400024 - 21400090
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
21400024 |
ggttcgaacccaagaccttgcatatattatgcattgtccctaccaactgagctaagctcacgaggac |
21400090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 8 - 87
Target Start/End: Complemental strand, 31798393 - 31798313
Alignment:
| Q |
8 |
tattgaaaagtgaaatgagtcaannnnnnngggacaatattttttt-gcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||| |||||||||||||||||||||| |||| |||||| |
|
|
| T |
31798393 |
tattgaaaagtgaaataggtcaattttcccgggacaatattttttttgcaaatgactcagttattatggaacggtgggagt |
31798313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 120 - 184
Target Start/End: Original strand, 41769817 - 41769883
Alignment:
| Q |
120 |
gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||| |||| ||||||||||| |||||||||||||| |
|
|
| T |
41769817 |
gtttgaaccccggaccttggatatattatgcattatccaaaccaactgagctaagctcacgaggaca |
41769883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 167
Target Start/End: Complemental strand, 46707943 - 46707884
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactg |
167 |
Q |
| |
|
||||||||||| |||||||||| ||| |||||||||||||||||| ||| ||||||||| |
|
|
| T |
46707943 |
gtggtggccgatgtttgaaccccggaacttgcatatattatgcattgtccttaccaactg |
46707884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 119 - 170
Target Start/End: Complemental strand, 50040416 - 50040365
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||| ||||||||||| |
|
|
| T |
50040416 |
ggtttgaaccctggaccttgcatattttatgcattgtcccaaccaactgagc |
50040365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 53 - 87
Target Start/End: Complemental strand, 7787603 - 7787569
Alignment:
| Q |
53 |
tgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
7787603 |
tgcaaatgactcagttattatgggacggagggagt |
7787569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 166
Target Start/End: Original strand, 8210375 - 8210433
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaact |
166 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| ||||||||||||| ||| |||||||| |
|
|
| T |
8210375 |
gtggtggccggggttcgaaccctggaccttgtatatattatgcattgtccttaccaact |
8210433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 8269358 - 8269420
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||| || ||||||||||| ||||||||||||||||||| || ||| |||||||||||| |
|
|
| T |
8269358 |
gtggtggtcggggtttgaaccccggaccttgcatatattatgtattgtccttaccaactgagc |
8269420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 38 - 80
Target Start/End: Complemental strand, 8773183 - 8773141
Alignment:
| Q |
38 |
gggacaatatttttttgcaaatgactcagttattatgggacgg |
80 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
8773183 |
gggacactttttttttgcaaatgactcagttattatgggacgg |
8773141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 119 - 169
Target Start/End: Original strand, 32497482 - 32497532
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
32497482 |
ggtttgaaccctagaccttgcatatattatgcattgttcctaccaactgag |
32497532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 35474023 - 35473961
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||| ||| |||| |||||||| |||||||||||||||||||| |||| |||||| ||||| |
|
|
| T |
35474023 |
gtggtgtccggggttcgaaccctgaaccttgcatatattatgcattatccttaccaattgagc |
35473961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 51503750 - 51503688
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||| ||| ||||||| ||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
51503750 |
gtggtggccggcgttcgaaccctagaccttggatatattatgcattgtccctaccaactgagc |
51503688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 108 - 165
Target Start/End: Complemental strand, 8736506 - 8736449
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaac |
165 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||| |||||||| ||| ||||||| |
|
|
| T |
8736506 |
gtggtggccggggtttgaaccccggaccttgcatattttatgcattgtccataccaac |
8736449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 119 - 168
Target Start/End: Original strand, 12268985 - 12269034
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga |
168 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| | |||||||||||| |
|
|
| T |
12268985 |
ggtttgaaccccggaccttgcatatattatgcattgttcctaccaactga |
12269034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 38 - 87
Target Start/End: Original strand, 28424415 - 28424464
Alignment:
| Q |
38 |
gggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||| ||| ||||||||| |
|
|
| T |
28424415 |
gggacaatattttttggcaaatgactaagttattataggatggagggagt |
28424464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 32962634 - 32962573
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||| |||||||| | | ||||||||||| |
|
|
| T |
32962634 |
gtggtggtcggggtttgaaccctggaccttgcatattttatgcattgttcataccaactgag |
32962573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 38 - 87
Target Start/End: Original strand, 36326351 - 36326400
Alignment:
| Q |
38 |
gggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||| |||||| || |||||||||| |||||||||||| |
|
|
| T |
36326351 |
gggacaatatttttttacaaatggcttagttattatgagacggagggagt |
36326400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 38 - 87
Target Start/End: Original strand, 46363574 - 46363623
Alignment:
| Q |
38 |
gggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||| || ||| |||||||||||||||||||||| |||||| |
|
|
| T |
46363574 |
gggacaatattttattacaattgactcagttattatgggacggcgggagt |
46363623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 129 - 169
Target Start/End: Original strand, 2889937 - 2889977
Alignment:
| Q |
129 |
ctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2889937 |
ctggaccttgcatatattatgcattgtccctaccaactgag |
2889977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 87
Target Start/End: Original strand, 3160920 - 3160964
Alignment:
| Q |
43 |
aatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| ||||||| |
|
|
| T |
3160920 |
aatatttttttgtaaataactcagttattatgggacgcagggagt |
3160964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 10587754 - 10587794
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
10587754 |
tttttttgctaatgactcagttattatgggacggaaggagt |
10587794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 133 - 169
Target Start/End: Original strand, 19396206 - 19396242
Alignment:
| Q |
133 |
accttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
19396206 |
accttgcatatattatgcattatccctaccaactgag |
19396242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 24752637 - 24752716
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcata-tattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| |||| |||||| ||||||||||| |||||||||| ||| |||||||||||| |||||||||||||| |
|
|
| T |
24752637 |
gtggtggccggggttcgaaccccagaccttgcatattattatgcattgtccataccaactgagctaagctcacgaggaca |
24752716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 32950751 - 32950795
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||||||||||||| |
|
|
| T |
32950751 |
gtggtggtcgaggtttgaactccggaccttgcatatattatgcat |
32950795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 185
Target Start/End: Original strand, 33020033 - 33020112
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacag |
185 |
Q |
| |
|
|||||||| | |||||||||| ||||||||||||||||||||| ||||||||| ||||| ||||||||||||||| |
|
|
| T |
33020033 |
gtggtggctggggtttgaacctcagaccttgcatatattatgcattgtccctaccagttgagctaagctcacgaggacag |
33020112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 168
Target Start/End: Complemental strand, 41974832 - 41974772
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga |
168 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
41974832 |
gtggtggccggggtttgaacctcaaaccttgcatatattatgcattatccctatcaactga |
41974772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 121 - 169
Target Start/End: Original strand, 48264474 - 48264522
Alignment:
| Q |
121 |
tttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||| ||||||||||||||| |||||||| |||| ||||||||||| |
|
|
| T |
48264474 |
tttgaactctggaccttgcatattttatgcattatccataccaactgag |
48264522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 3509931 - 3509993
Alignment:
| Q |
108 |
gtggtggccgaggtttgaa-ccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||||| ||||||| ||| |||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
3509931 |
gtggtggccga-gtttgaacccccggaccttgcatatattatgcattgtccataccaactgagc |
3509993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 109 - 164
Target Start/End: Complemental strand, 8094111 - 8094056
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaa |
164 |
Q |
| |
|
||||||||| ||||| ||||| | ||||||||||||||||||||| ||| |||||| |
|
|
| T |
8094111 |
tggtggccggggtttaaaccccgcaccttgcatatattatgcatcgtccataccaa |
8094056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 19620647 - 19620569
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||| || || ||||||||| ||||||||||||||||||| || ||| |||||||||||| |||||||| ||||| |
|
|
| T |
19620647 |
gtggtgtccaagatttgaaccccggaccttgcatatattatgtattgtccttaccaactgagctaagctcacggggaca |
19620569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 119 - 170
Target Start/End: Original strand, 26803452 - 26803503
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||| ||| |||||||||||| |
|
|
| T |
26803452 |
ggtttgaaccccggactttgcatatattatgcattgtccataccaactgagc |
26803503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 56 - 87
Target Start/End: Original strand, 36057796 - 36057827
Alignment:
| Q |
56 |
aaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
36057796 |
aaatgactcagttattatgggacggagggagt |
36057827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 40 - 83
Target Start/End: Original strand, 36232954 - 36232997
Alignment:
| Q |
40 |
gacaatatttttttgcaaatgactcagttattatgggacggagg |
83 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
36232954 |
gacaatatttttttacaaatgactcagttgttatggaacggagg |
36232997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 120 - 184
Target Start/End: Complemental strand, 36679649 - 36679583
Alignment:
| Q |
120 |
gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||| |||| | ||||||||| |||||||||||||| |
|
|
| T |
36679649 |
gtttgaaccccggaccttgcatatattatccattgtcccgatcaactgagccaagctcacgaggaca |
36679583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 119 - 183
Target Start/End: Original strand, 37944131 - 37944197
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggac |
183 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||| |||| |||||| |||| ||||||||||||| |
|
|
| T |
37944131 |
ggtttgaaccctggatcttacatatattatgcattatccttaccaattgagataagctcacgaggac |
37944197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 119 - 170
Target Start/End: Complemental strand, 44243933 - 44243882
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||| | |||||||||||||| |
|
|
| T |
44243933 |
ggtttgaactctggaccttacatatattatgcattgttcctaccaactgagc |
44243882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 135 - 170
Target Start/End: Complemental strand, 51370617 - 51370582
Alignment:
| Q |
135 |
cttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
51370617 |
cttgcatatattatgcatcatccttaccaactgagc |
51370582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 52441501 - 52441579
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| |||| ||| | |||||||||||||||||||||| || |||||||||||| |||||||||||||| |
|
|
| T |
52441501 |
gtggtggccggggttcaaacgccggaccttgcatatattatgcattgtctataccaactgagctaagctcacgaggaca |
52441579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 45 - 87
Target Start/End: Original strand, 2246465 - 2246507
Alignment:
| Q |
45 |
tatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||| ||||| |
|
|
| T |
2246465 |
tatttttttgcaaatgactcagttattttgtgacggatggagt |
2246507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 2 - 80
Target Start/End: Original strand, 5115952 - 5116031
Alignment:
| Q |
2 |
atgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttg-caaatgactcagttattatgggacgg |
80 |
Q |
| |
|
||||| |||||||||||||||||| |||| |||||||||||||||| ||||||| ||||||||||||| |||| |
|
|
| T |
5115952 |
atgttatattgaaaagtgaaatgaatcaatattattgggacaatattttttttacaaatgattcagttattatggaacgg |
5116031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 111 - 169
Target Start/End: Original strand, 7574111 - 7574169
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||| |||||||||||| | ||||||||||||| ||||||| ||| ||||||||||| |
|
|
| T |
7574111 |
gtggctgaggtttgaaccattgaccttgcatatactatgcattgtccttaccaactgag |
7574169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 12783691 - 12783753
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||||||||| ||||| | ||||| ||||||||||||||| ||| |||||| ||||| |
|
|
| T |
12783691 |
gtggtggccgaggttcgaaccttagacctcgcatatattatgcattgtccataccaattgagc |
12783753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 111 - 186
Target Start/End: Complemental strand, 13054941 - 13054864
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacaga |
186 |
Q |
| |
|
|||| ||||||| ||||| ||||||||||||||||||||| |||||||||||| ||| ||||||| |||||||| |
|
|
| T |
13054941 |
gtggtcgaggttcgaacctccgaccttgcatatattatgcattgtccctaccaactaagctaagctcacaaggacaga |
13054864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 47 - 81
Target Start/End: Original strand, 19533091 - 19533125
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacgga |
81 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
19533091 |
tttttttgcaaatgactcagttattacgggacgga |
19533125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 109 - 147
Target Start/End: Original strand, 19795107 - 19795145
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatatta |
147 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
19795107 |
tggtggccggggtttgaaccccggaccttgcatatatta |
19795145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 38 - 87
Target Start/End: Original strand, 25983789 - 25983839
Alignment:
| Q |
38 |
gggacaatatttttttgc-aaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||| | |||||||||| ||||||| ||||||||||||| |
|
|
| T |
25983789 |
gggacaatattttttttccaaatgactcacttattataggacggagggagt |
25983839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 169
Target Start/End: Complemental strand, 29800593 - 29800543
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||||||| |||||||||||| |||||||| |||| ||||||||||| |
|
|
| T |
29800593 |
ggtttgaacccccgaccttgcatattttatgcattatccttaccaactgag |
29800543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 169
Target Start/End: Original strand, 33153881 - 33153931
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
33153881 |
ggtttgaacctcggaccttacatatattatgcattgtccctaccaactgag |
33153931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 132 - 183
Target Start/End: Original strand, 37098495 - 37098548
Alignment:
| Q |
132 |
gaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||| ||||||||||||| |
|
|
| T |
37098495 |
gaccttgcatatattattcattgtccctaccaactgagctaagctcacgaggac |
37098548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 124 - 170
Target Start/End: Original strand, 38448872 - 38448918
Alignment:
| Q |
124 |
gaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
38448872 |
gaaccccggaccttgcatatattatgcattgtccttaccaactgagc |
38448918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 42888646 - 42888584
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||| | |||| |||||| ||||||||||||| |||||||| ||| |||||||||||| |
|
|
| T |
42888646 |
gtggtggcgggggttcgaaccccggaccttgcatattttatgcattgtccataccaactgagc |
42888584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 45049014 - 45048927
Alignment:
| Q |
1 |
aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaata-tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| ||||||| ||||||| ||||||| ||||||||| ||||| |
|
|
| T |
45049014 |
aatgttgtattgaaaattgaaatgagtcaaaattcttgggacaatattttttttacaaatgagtcagttaaactgggacggaaggagt |
45048927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 81
Target Start/End: Original strand, 50773502 - 50773540
Alignment:
| Q |
43 |
aatatttttttgcaaatgactcagttattatgggacgga |
81 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
50773502 |
aatatttttttgcaaatgacttaattattatgggacgga |
50773540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 6000133 - 6000194
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||| ||| |||||||||| |||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
6000133 |
gtggtgtccggggtttgaacctcggaccttgcatatattatgcattgtcctaaccaactgag |
6000194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 145
Target Start/End: Original strand, 6423751 - 6423788
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatat |
145 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
6423751 |
gtggtggccggggtttgaaccccggaccttgcatatat |
6423788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 9639807 - 9639868
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||| |||||||| |||| | |||||||||||||||||||||| ||| |||||| |||| |
|
|
| T |
9639807 |
gtggtgtccgaggttcgaactccggaccttgcatatattatgcattgtccttaccaagtgag |
9639868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 133 - 170
Target Start/End: Original strand, 9872120 - 9872157
Alignment:
| Q |
133 |
accttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
9872120 |
accttgcatatattatgcattatccttaccaactgagc |
9872157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 119 - 152
Target Start/End: Original strand, 9929232 - 9929265
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
9929232 |
ggttttaaccctggaccttgcatatattatgcat |
9929265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 10356173 - 10356234
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||| ||| |||||| ||||| |||||||||||||||| ||| ||||||||||| |
|
|
| T |
10356173 |
gtggtggccggagttcgaaccccggaccgtgcatatattatgcattgtccataccaactgag |
10356234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 165
Target Start/End: Complemental strand, 13778632 - 13778575
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaac |
165 |
Q |
| |
|
||||||| |||||||||||||| | ||||||||||| |||||||| || | ||||||| |
|
|
| T |
13778632 |
gtggtggtcgaggtttgaaccccgaaccttgcatattttatgcattattcataccaac |
13778575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 113 - 170
Target Start/End: Original strand, 16533028 - 16533085
Alignment:
| Q |
113 |
ggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||| |||||||| ||| ||||||||||||||||||||| | ||||||||| |||| |
|
|
| T |
16533028 |
ggccggggtttgaatcctagaccttgcatatattatgcattgttcctaccaaccgagc |
16533085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 17669716 - 17669655
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||| |||||||||| | |||||||||||||||| ||| |||||| |||||||| |
|
|
| T |
17669716 |
gtggtggccggagtttgaaccccgaaccttgcatatattatacattgtccctatcaactgag |
17669655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 121 - 170
Target Start/End: Complemental strand, 22346734 - 22346685
Alignment:
| Q |
121 |
tttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||| ||||||||||||| |||||||| |||| ||||||||||| |
|
|
| T |
22346734 |
tttgaaccccggaccttgcatattttatgcattatccaaaccaactgagc |
22346685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 9 - 79
Target Start/End: Original strand, 24131534 - 24131604
Alignment:
| Q |
9 |
attgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacg |
79 |
Q |
| |
|
||||||||||||||| |||||| |||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
24131534 |
attgaaaagtgaaataagtcaatttttctgggacatattttttttacaaatgactcagttattatgggacg |
24131604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 124 - 169
Target Start/End: Complemental strand, 24631894 - 24631849
Alignment:
| Q |
124 |
gaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||| |||| |||||||||||||||||| |||| ||||||||||| |
|
|
| T |
24631894 |
gaaccttggatcttgcatatattatgcattatccttaccaactgag |
24631849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 121 - 170
Target Start/End: Complemental strand, 25086541 - 25086492
Alignment:
| Q |
121 |
tttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||| |||||||||||| |
|
|
| T |
25086541 |
tttgaaccctagaccttgcatattttatgcattgtccataccaactgagc |
25086492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 26760135 - 26760054
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||| |||||| |||||| |||| ||||||| |||||||| |||| |
|
|
| T |
26760135 |
ttgtattgaaaagtgaaatgaatcaatttttctgggacaata-ttttttacaaatggctcaattattataggacggagtgagt |
26760054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 29042608 - 29042547
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||| || | ||||||||| ||| ||| |||||||||||||| ||||||||||| |||| |
|
|
| T |
29042608 |
gtggtggtcgggatttgaaccccggatcttacatatattatgcattatccctaccaattgag |
29042547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 30382567 - 30382506
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| |||||||| ||| |||||||||| |
|
|
| T |
30382567 |
gtggtggccgaggtttgaacgccagaccttgcatattttatgcattgtccaaaccaactgag |
30382506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 118 - 184
Target Start/End: Complemental strand, 30795762 - 30795694
Alignment:
| Q |
118 |
aggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||| | | |||||||||||| || ||||||||||| |
|
|
| T |
30795762 |
aggttcgaaccttggaccttgcatatattatgcattgttcttaccaactgagctaagttcacgaggaca |
30795694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 38 - 87
Target Start/End: Complemental strand, 32347889 - 32347840
Alignment:
| Q |
38 |
gggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||| |||| ||| ||||| || ||||||||||||||||||||||| |
|
|
| T |
32347889 |
gggacaattttttattgaaaatggcttagttattatgggacggagggagt |
32347840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 34766931 - 34766870
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||||||||||| |||||| |||||||||| |||||| ||| ||| ||||||||||| |
|
|
| T |
34766931 |
gtggtggccgaggttcgaaccccagaccttgcatgtattatacattgtccataccaactgag |
34766870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 47719097 - 47719158
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||| | || |||| | | |||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
47719097 |
gtggtggccgggattcgaactccgaaccttgcatatattatgcattatccttaccaactgag |
47719158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 64668 - 64712
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||| |||||||||||| | |||| ||||||||||||||||| |
|
|
| T |
64668 |
gtggtggacgaggtttgaactccggactttgcatatattatgcat |
64712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 79
Target Start/End: Original strand, 8903469 - 8903505
Alignment:
| Q |
43 |
aatatttttttgcaaatgactcagttattatgggacg |
79 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
8903469 |
aatatttttttgcaaatgagtcatttattatgggacg |
8903505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 168
Target Start/End: Original strand, 10132434 - 10132494
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga |
168 |
Q |
| |
|
|||||| || ||||| |||||| ||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
10132434 |
gtggtgtccaaggttcgaaccccagaccttgcatatattatgcattgtccttaccaactga |
10132494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 121 - 169
Target Start/End: Original strand, 12852205 - 12852253
Alignment:
| Q |
121 |
tttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||||| || ||| |||||||||||||| |||||||||||||||| |
|
|
| T |
12852205 |
tttgaaccccagatcttacatatattatgcattatccctaccaactgag |
12852253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 40 - 87
Target Start/End: Complemental strand, 16956325 - 16956280
Alignment:
| Q |
40 |
gacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||| |||||||||||| |
|
|
| T |
16956325 |
gacaatatttttttgcaaatgactc--ttactatgtgacggagggagt |
16956280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 148
Target Start/End: Complemental strand, 23309538 - 23309498
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattat |
148 |
Q |
| |
|
||||||| ||||||||||| ||| ||||||||||||||||| |
|
|
| T |
23309538 |
gtggtggtcgaggtttgaagcctagaccttgcatatattat |
23309498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 124 - 152
Target Start/End: Original strand, 23405364 - 23405392
Alignment:
| Q |
124 |
gaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23405364 |
gaaccctggaccttgcatatattatgcat |
23405392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 121 - 169
Target Start/End: Complemental strand, 32561031 - 32560983
Alignment:
| Q |
121 |
tttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||||| |||||||||||||||||| ||| ||| ||||||||||| |
|
|
| T |
32561031 |
tttgaaccccggaccttgcatatattatacattgtccataccaactgag |
32560983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 82
Target Start/End: Original strand, 35622909 - 35622985
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggag |
82 |
Q |
| |
|
|||||||||| ||||||||| ||||| ||||||||| |||||||||||| |||||||||||||| |||||| |
|
|
| T |
35622909 |
ttgtattgaagagtgaaatgtgtcaatttttttgggacaatagatttttgcaaatg-ctcagttattatggaacggag |
35622985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 40613094 - 40613050
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||| |||| || |||||| |||||||||||||||||||||| |
|
|
| T |
40613094 |
gtggtggtcgagattcgaaccccggaccttgcatatattatgcat |
40613050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 137 - 169
Target Start/End: Original strand, 41972749 - 41972781
Alignment:
| Q |
137 |
tgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
41972749 |
tgcatatattatgcattatccctaccaactgag |
41972781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 47417854 - 47417810
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||| ||||||||||||| | | |||||||||||||||||||| |
|
|
| T |
47417854 |
gtggtgaccgaggtttgaactccgaaccttgcatatattatgcat |
47417810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 185
Target Start/End: Original strand, 47528437 - 47528516
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacag |
185 |
Q |
| |
|
|||||| ||| |||| ||||| ||||||||| |||||||||||| ||| |||||||||||| |||||||| |||||| |
|
|
| T |
47528437 |
gtggtgtccggggttcgaacctcggaccttgcgtatattatgcattgtccttaccaactgagctaagctcacggggacag |
47528516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 50269656 - 50269696
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
50269656 |
tttttttgcaaatggctatgttattatgggacggagggagt |
50269696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 52432243 - 52432203
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
52432243 |
tttttttgcaaataactcagttattgagggacggagggagt |
52432203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 115)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 6489078 - 6489000
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
6489078 |
gtggtggccggggtttgaaccccagaccttgcatatattatgcattgtccctaccaactgagctaagctcacgaggaca |
6489000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 15889482 - 15889405
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
||||||| || |||||||||||| ||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
15889482 |
gtggtggtcggggtttgaaccctagaccttgcatatattatgcattgtccctaccaactgagctaagctcacgaggac |
15889405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 108 - 186
Target Start/End: Complemental strand, 34436922 - 34436842
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacaga |
186 |
Q |
| |
|
||||||| || ||||||||||| || ||||||||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
34436922 |
gtggtgggcggggtttgaaccccggcccttgcatatattatgcattgtccctaccaactgagctaagctcacgaggacaga |
34436842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 22522791 - 22522869
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||||||| ||| ||||||| |||| |||||||||||||| |
|
|
| T |
22522791 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccataccaaccgagctaagctcacgaggaca |
22522869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 5 - 87
Target Start/End: Original strand, 4044606 - 4044689
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatattt-ttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||||||| |||| |||||| | ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4044606 |
ttgtattgaaaagtgaaatgattcaattattttgggacattttttattttgcaaatgactcagttattatgggacggagggagt |
4044689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 5485257 - 5485180
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
||||||||| ||||| |||||| |||| ||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
5485257 |
gtggtggccaaggttagaaccccggacattgcatatattatgcattgtccctaccaactgagctaagctcacgaggac |
5485180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 111 - 168
Target Start/End: Complemental strand, 33412159 - 33412102
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga |
168 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
33412159 |
gtggccggggtttgaatcctggaccttgcatatattatgcatctttcctaccaactga |
33412102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 118 - 184
Target Start/End: Original strand, 35270681 - 35270749
Alignment:
| Q |
118 |
aggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||| ||||||||||| |||||||||||||| |
|
|
| T |
35270681 |
aggtttgaaccctggaccttgcatattttatgcattgtcccaaccaactgagctaagctcacgaggaca |
35270749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 108 - 168
Target Start/End: Original strand, 22499113 - 22499173
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga |
168 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||| |||| ||| ||||||||||| |
|
|
| T |
22499113 |
gtggtggccgagttttgaaccctgaaccttgcatatattaagcattatcactaccaactga |
22499173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 39 - 87
Target Start/End: Original strand, 36007053 - 36007101
Alignment:
| Q |
39 |
ggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
36007053 |
ggacaatatttttttacaaatgactcagttattatgagacggagggagt |
36007101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 6624847 - 6624769
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| |||| |||||| |||||||||||||||||||||| ||| | |||||||||| |||||||||||||| |
|
|
| T |
6624847 |
gtggtggccggggttcgaaccccggaccttgcatatattatgcattgtccatgccaactgagctaagctcacgaggaca |
6624769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 32565595 - 32565517
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||||| |||||||||| ||||||| |||||||||||||| |||||||||| |||||| |||||||||||||| |
|
|
| T |
32565595 |
gtggtggccaaggtttgaacttcggaccttacatatattatgcattatccctaccagctgagctaagctcacgaggaca |
32565517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 111 - 183
Target Start/End: Complemental strand, 34191501 - 34191427
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||| |||||||| |||| ||||||||||| ||||||||||||| |
|
|
| T |
34191501 |
gtggccggggtttgaaccccggaccttgcatattttatgcattgtcccaaccaactgagctaagctcacgaggac |
34191427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 37932401 - 37932323
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||||| |||| |||||| |||||||||||||||||||||| ||| |||||||||||| |||||||||||||| |
|
|
| T |
37932401 |
gtggtggccagggttcgaaccccggaccttgcatatattatgcattgtccataccaactgagctaagctcacgaggaca |
37932323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 3445237 - 3445314
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||| | ||||||||| |||||||||||| ||||||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
3445237 |
gtggtggccgggatttgaaccccggaccttgcatacattatgcattgtccttaccaactgagctaagctcacgaggac |
3445314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 150
Target Start/End: Complemental strand, 14474905 - 14474863
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgc |
150 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
14474905 |
gtggtggccggggtttgaaccctggaccttgcatatattatgc |
14474863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 17090937 - 17090875
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||| ||||||||| |||| |||||||||||| |
|
|
| T |
17090937 |
gtggtggccggggtttgaaccccggaccttgcattaattatgcattatccataccaactgagc |
17090875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 40715939 - 40716016
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||||||| ||| || ||| ||||| ||||||||||||| |
|
|
| T |
40715939 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccatatcaattgagctaagctcacgaggac |
40716016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 5 - 79
Target Start/End: Complemental strand, 4194618 - 4194544
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacg |
79 |
Q |
| |
|
|||||||||||||||||||| || || ||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
4194618 |
ttgtattgaaaagtgaaatgggttaatttttctgggacaatatttttttgtaaatggctcagttattatgggacg |
4194544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 11720964 - 11720904
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||| ||||||||||| | |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11720964 |
gtggtggccggggtttgaaccccg-accttgcatatattatgcattgtccctaccaactgag |
11720904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 108 - 182
Target Start/End: Original strand, 16701571 - 16701647
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgagga |
182 |
Q |
| |
|
||||||| || |||||||| || |||||||||||||||||| ||| |||||||||||||||| |||||||||||| |
|
|
| T |
16701571 |
gtggtggtcggggtttgaatcccggaccttgcatatattattcattgtccctaccaactgagctaagctcacgagga |
16701647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 25109995 - 25110081
Alignment:
| Q |
1 |
aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||||| |||||||||| | ||||||||||||||||||||| ||| ||||||| ||||||| ||||| |
|
|
| T |
25109995 |
aatgttgtattgaaaagtggaatgagtcaaattttttgaaacaatatttttttgcaaatgattcacttattataggacggatggagt |
25110081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 25169087 - 25169173
Alignment:
| Q |
1 |
aatgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||||| |||||||||| | ||||||||||||||||||||| ||| ||||||| ||||||| ||||| |
|
|
| T |
25169087 |
aatgttgtattgaaaagtggaatgagtcaaattttttgaaacaatatttttttgcaaatgattcacttattataggacggatggagt |
25169173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 34534902 - 34534820
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||| ||| |||| ||||||||||||||||| ||||| |||| ||||||||||| ||||||||| |
|
|
| T |
34534902 |
ttgtattgaaaagtgaactgaatcaatttttttgggacaatatttttttgtaaatggctcacttattatgggatggagggagt |
34534820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 4009938 - 4009859
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatatt-atgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| ||||||||||| || ||||||||||||| |||||| ||| |||||||||||| |||||||||||||| |
|
|
| T |
4009938 |
gtggtggccggggtttgaaccccggcccttgcatatattaatgcattgtccttaccaactgagctaagctcacgaggaca |
4009859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 6610771 - 6610731
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6610771 |
tttttttgaaaatgactcagttattatgggacggagggagt |
6610731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 110 - 182
Target Start/End: Complemental strand, 16094126 - 16094054
Alignment:
| Q |
110 |
ggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagcagctcacgagga |
182 |
Q |
| |
|
||||| || ||||||||||| || ||| |||||||||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
16094126 |
ggtggtcggggtttgaaccccagatcttacatatattatgcattatccctatcaactgagcaactcacgagga |
16094054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 39 - 87
Target Start/End: Complemental strand, 16926379 - 16926331
Alignment:
| Q |
39 |
ggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||| ||||| |
|
|
| T |
16926379 |
ggacaatatttttttacaaatgactcagttattatgggatggaaggagt |
16926331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 119 - 184
Target Start/End: Complemental strand, 24408555 - 24408488
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
24408555 |
ggtttgaaccccagaccttgcatatattatgcatcgtccaaaccaactgagctaagctcacgaggaca |
24408488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 108 - 181
Target Start/End: Complemental strand, 39980579 - 39980504
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgagg |
181 |
Q |
| |
|
||||||| || ||||||||| | ||||||||||||| |||||||| |||| |||||||||||| ||||||||||| |
|
|
| T |
39980579 |
gtggtggtcggggtttgaactccggaccttgcatattttatgcattatccataccaactgagctaagctcacgagg |
39980504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 3 - 75
Target Start/End: Complemental strand, 5072932 - 5072860
Alignment:
| Q |
3 |
tgttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgg |
75 |
Q |
| |
|
|||||||||||||||||||||| |||| || |||||||||||| |||||||||||||||||||||| |
|
|
| T |
5072932 |
tgttgtattgaaaagtgaaatggatcaatttttttggaacaatattttttagcaaatgactcagttattatgg |
5072860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 109 - 152
Target Start/End: Complemental strand, 25979914 - 25979871
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
25979914 |
tggtggccgaggtttgaaccccggaccttgcatacattatgcat |
25979871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 31708136 - 31708214
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagca--gctcacgaggaca |
184 |
Q |
| |
|
|||||| |||||||| |||||| ||||||||||||||||||||| | | ||||||||||||| ||||||||||||| |
|
|
| T |
31708136 |
gtggtgtccgaggttcgaaccccagaccttgcatatattatgcattgttcataccaactgagcaatgctcacgaggaca |
31708214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 132 - 170
Target Start/End: Complemental strand, 11017223 - 11017185
Alignment:
| Q |
132 |
gaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
11017223 |
gaccttgcatatattatgcattatccctaccaactgagc |
11017185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 17862050 - 17861988
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||| ||| ||||||||||| || ||||||||||||||||| |||||||||||||||| |
|
|
| T |
17862050 |
gtggtggacgaaatttgaaccctgaactttgcatatattatgcattgtccctaccaactgagc |
17861988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 133 - 184
Target Start/End: Original strand, 20370145 - 20370198
Alignment:
| Q |
133 |
accttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
20370145 |
accttgtatatattatgcattatccctaccaactgagctaagctcacgaggaca |
20370198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 26655535 - 26655473
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||| |||| |||||| ||||||| |||||||||||||| ||| |||||||||||| |
|
|
| T |
26655535 |
gtggtggccggggttcgaaccccggaccttacatatattatgcattgtccataccaactgagc |
26655473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 26927120 - 26927058
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||| |||| |||||| ||||||| |||||||||||||| ||| |||||||||||| |
|
|
| T |
26927120 |
gtggtggccggggttcgaaccccggaccttacatatattatgcattgtccataccaactgagc |
26927058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 112 - 169
Target Start/End: Original strand, 979819 - 979876
Alignment:
| Q |
112 |
tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||| |||||||||||| ||| |||||||||||||||||| || ||| |||||||| |
|
|
| T |
979819 |
tggccggggtttgaaccctagacgttgcatatattatgcatcgtctctatcaactgag |
979876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 3725165 - 3725083
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||||||| ||| ||||| | |||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3725165 |
ttgtattgaaaagtgaaatgactcagttattttaggacacttttttattgcaaatgattcagttattatgggacggagggagt |
3725083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 38 - 83
Target Start/End: Complemental strand, 4475190 - 4475145
Alignment:
| Q |
38 |
gggacaatatttttttgcaaatgactcagttattatgggacggagg |
83 |
Q |
| |
|
||||||||||||| | |||||||||||||||||| ||||||||||| |
|
|
| T |
4475190 |
gggacaatattttatagcaaatgactcagttattttgggacggagg |
4475145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 15898170 - 15898088
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||||| |||||| | ||||||||||||||||||| |||||||||||||||| | ||||||| |
|
|
| T |
15898170 |
ttgtattgaaaagtgaaataagtcaatttttctgaaacaatatttttttgcaaatagctcagttattatgggatgaagggagt |
15898088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 31090282 - 31090201
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||||||||| | |||||||| ||||||||| ||||||||| |||||||||||| |||||||| |
|
|
| T |
31090282 |
ttgtattgaaaagtgaaatgagttatttttactgggacaat-tttttttgcgaatgactcaattattatgggacagagggagt |
31090201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 109 - 183
Target Start/End: Original strand, 32200438 - 32200514
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||| || || |||||||| |||||||||||||||||||||| ||||| ||||||||| ||||||||||||| |
|
|
| T |
32200438 |
tggtggtcggggcttgaaccccggaccttgcatatattatgcattgtccctgtcaactgagctaagctcacgaggac |
32200514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 83
Target Start/End: Original strand, 39061084 - 39061162
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagg |
83 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||| |||||| ||||||||||||||| ||||| |
|
|
| T |
39061084 |
ttgtattgaaaagtgaaatgaatcaatttttctatgacaatatttttttgtaaatgattcagttattatgggatggagg |
39061162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 111 - 152
Target Start/End: Complemental strand, 42473962 - 42473921
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
42473962 |
gtggccgtggtttgaaccccggaccttgcatatattatgcat |
42473921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 6629552 - 6629592
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
6629552 |
tttttttgcaaatggctcagttattatgagacggagggagt |
6629592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 39 - 87
Target Start/End: Original strand, 16926253 - 16926301
Alignment:
| Q |
39 |
ggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||||| |||| |
|
|
| T |
16926253 |
ggacaatatttttttacaaatggatcagttattatgggacggagagagt |
16926301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 22583044 - 22583084
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
22583044 |
tttttttgcaaatgacttagttattgtgggacggagggagt |
22583084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 109 - 186
Target Start/End: Complemental strand, 25509381 - 25509302
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggacaga |
186 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||| ||||||| ||||||| ||||||| |||||||||||||||| |
|
|
| T |
25509381 |
tggtggccgaggttcgaacctcggaccttgcatattatatgcattgtccctactaactgagttaagctcacgaggacaga |
25509302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 25814296 - 25814256
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
25814296 |
tttttttgcaaatgtctcagttattatgggacggatggagt |
25814256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 148
Target Start/End: Complemental strand, 27086149 - 27086109
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattat |
148 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
27086149 |
gtggtggctggggtttgaaccctggaccttgcatatattat |
27086109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 39008066 - 39008026
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
39008066 |
tttttttgcaaataactcagttattgtgggacggagggagt |
39008026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 41184041 - 41184001
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
41184041 |
ttttttttcaaatgactcagttattatgggagggagggagt |
41184001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 42817102 - 42817146
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||| |||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
42817102 |
gtggtggtcgaggtttgaaccccggaccttgtatatattatgcat |
42817146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 120 - 184
Target Start/End: Complemental strand, 2839857 - 2839791
Alignment:
| Q |
120 |
gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| | |||||| ||||||||||||| |||| ||||||||||| |||||||||||||| |
|
|
| T |
2839857 |
gtttgaaccccgaaccttggatatattatgcattatccaaaccaactgagctaagctcacgaggaca |
2839791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 111 - 170
Target Start/End: Original strand, 10704324 - 10704383
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||| |||||||||| ||||||||||||| |||||||| ||| |||||||||||| |
|
|
| T |
10704324 |
gtggccgtagtttgaaccccggaccttgcatattttatgcattgtccataccaactgagc |
10704383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 13220611 - 13220688
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||| |||| ||||||||||| | || |||| ||||||||||||| ||| |||||||||||| |||||||||||||| |
|
|
| T |
13220611 |
gtggttgccggggtttgaaccc-gaactttgcgtatattatgcatcgtccttaccaactgagctaagctcacgaggaca |
13220688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 18331778 - 18331700
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| || |||||||| ||||||||||||| |||||||| ||| |||||| ||||| ||||||| |||||| |
|
|
| T |
18331778 |
gtggtggccggggcttgaaccccggaccttgcatattttatgcattgtccataccaagtgagctaagctcacaaggaca |
18331700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 133 - 185
Target Start/End: Complemental strand, 20211326 - 20211272
Alignment:
| Q |
133 |
accttgcatatattatgcatcatccctaccaactgag--cagctcacgaggacag |
185 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| ||||||||||||||| |
|
|
| T |
20211326 |
accttgcatatattatgtattatccctaccaactgagataagctcacgaggacag |
20211272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 28207203 - 28207125
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| | || ||||| ||||||||||||| |||||||| ||| |||||||||||| |||||||||||||| |
|
|
| T |
28207203 |
gtggtggccgggattcgaacctcggaccttgcatattttatgcattgtccataccaactgagctaagctcacgaggaca |
28207125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 37614417 - 37614495
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||||||| ||||||||| | |||||||||||||||||| | || ||||||||||||| ||||||||| |||| |
|
|
| T |
37614417 |
gtggtggccgaagtttgaacctcgaaccttgcatatattatgcgttgtctctaccaactgagctaagctcacgacgaca |
37614495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 47 - 86
Target Start/End: Original strand, 39212746 - 39212785
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggag |
86 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
39212746 |
tttttttgcaaatggctcagttattttgggacggagggag |
39212785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 169
Target Start/End: Original strand, 866028 - 866078
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||||||| ||||||||||||| |||| ||| |||| ||||||||||| |
|
|
| T |
866028 |
ggtttgaaccccggaccttgcatattttatacattatccataccaactgag |
866078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 169
Target Start/End: Complemental strand, 3671278 - 3671228
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||| |||| || |||||||| |
|
|
| T |
3671278 |
ggttcgaaccctggaccttgcatatattatacattatccttatcaactgag |
3671228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 165
Target Start/End: Original strand, 6424904 - 6424950
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaac |
165 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||| ||||||||||| |
|
|
| T |
6424904 |
ggtttgaaccccggaccttgtatatattatgcattgtccctaccaac |
6424950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 47 - 85
Target Start/End: Complemental strand, 7276320 - 7276282
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggaggga |
85 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
7276320 |
tttttttgcaaatggctcagttattttgggacggaggga |
7276282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 11844428 - 11844490
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||| |||| || ||||||| |||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
11844428 |
gtggtggtcgagattcgaaccctaaaccttgcatatattatgcattgtccttaccaactgagc |
11844490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 120 - 183
Target Start/End: Original strand, 17210711 - 17210776
Alignment:
| Q |
120 |
gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
17210711 |
gtttgaaccccacaccttgcatatattatgcactgtccctaccaactgagctaagctcacgaggac |
17210776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 18391671 - 18391609
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||| ||||||| ||||| ||||||||||||| |||||||| ||| |||||||||||| |
|
|
| T |
18391671 |
gtggtggtcgaggttcgaacctcggaccttgcatattttatgcattgtccttaccaactgagc |
18391609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 18789107 - 18789045
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||| | ||||||||||| | ||||||||||| |||||||| || ||||||||||||| |
|
|
| T |
18789107 |
gtggtggctggggtttgaaccccgaaccttgcatattttatgcattgtctctaccaactgagc |
18789045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 169
Target Start/End: Complemental strand, 20258605 - 20258555
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||| ||| |||| |||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
20258605 |
ggttcgaatcctgcaccttgcatatattatgcattatccataccaactgag |
20258555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 169
Target Start/End: Complemental strand, 20721110 - 20721060
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||||||| ||||||||||||||||||| || ||| ||||||||||| |
|
|
| T |
20721110 |
ggtttgaaccccggaccttgcatatattatgtattgtccataccaactgag |
20721060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 27679569 - 27679507
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||| ||| | ||||||||| | |||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
27679569 |
gtggtgtccgggatttgaaccccgaaccttgcatatattatgcattatctttaccaactgagc |
27679507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 87
Target Start/End: Complemental strand, 33012288 - 33012250
Alignment:
| Q |
49 |
tttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
33012288 |
tttttgcaaatgactcggttattatgggacggagtgagt |
33012250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 37021362 - 37021424
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||| || ||||||||||||| | |||||||||||||||||| |||| ||||| ||||| |
|
|
| T |
37021362 |
gtggtggtcggggtttgaaccctgaatcttgcatatattatgcattatccaaaccaattgagc |
37021424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 37462182 - 37462106
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||||||| |||||||| | |||||||||| ||| ||||||||||||| |
|
|
| T |
37462182 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac |
37462106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 169
Target Start/End: Complemental strand, 38495202 - 38495152
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||||||| | ||||||||||| |||||||| |||| ||||||||||| |
|
|
| T |
38495202 |
ggtttgaaccccgaaccttgcatattttatgcattatccataccaactgag |
38495152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 5 - 87
Target Start/End: Original strand, 72235 - 72317
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||| |||||||||||| || ||||||||| ||||| |||||| |
|
|
| T |
72235 |
ttgtattgaaaagtgaaatgggtcaatttttttgggacaatacttttttgcaaattgcttggttattatgtgacggtgggagt |
72317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 112 - 169
Target Start/End: Complemental strand, 3389229 - 3389172
Alignment:
| Q |
112 |
tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||| |||||||||| || |||||||||||||||||| ||| ||||||||||| |
|
|
| T |
3389229 |
tggccgatgtttgaaccccagatcttgcatatattatgcattgtccataccaactgag |
3389172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 109 - 170
Target Start/End: Complemental strand, 5846099 - 5846038
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||| ||| ||||||||||| ||| ||||||||||||||||| ||| |||||||||||| |
|
|
| T |
5846099 |
tggtgtccggggtttgaaccccagactttgcatatattatgcattgtccttaccaactgagc |
5846038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 8350741 - 8350680
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||||| || ||||||| ||| ||||||||||||||||| ||| | ||||||||| |
|
|
| T |
8350741 |
gtggtggccgagattcgaaccctagactttgcatatattatgcattgtccatgccaactgag |
8350680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 109 - 170
Target Start/End: Original strand, 12909157 - 12909218
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||| |||||| ||||||| ||||| |||||||||||||| | | |||||||||||| |
|
|
| T |
12909157 |
tggtggccaaggtttaaaccctgaaccttacatatattatgcattgttcataccaactgagc |
12909218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 13864415 - 13864354
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||| || ||||||||||| ||||||||||||||||||| || | | ||||||||||| |
|
|
| T |
13864415 |
gtggtggtcggggtttgaaccccggaccttgcatatattatgtattgttcataccaactgag |
13864354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 133 - 170
Target Start/End: Original strand, 19068454 - 19068491
Alignment:
| Q |
133 |
accttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
19068454 |
accttgcatatattatgcattatccataccaactgagc |
19068491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 149
Target Start/End: Original strand, 21594376 - 21594417
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatg |
149 |
Q |
| |
|
||||||||| || |||||||| |||||||||||||||||||| |
|
|
| T |
21594376 |
gtggtggccaagctttgaaccttggaccttgcatatattatg |
21594417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 149
Target Start/End: Original strand, 21598493 - 21598534
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatg |
149 |
Q |
| |
|
||||||||| || |||||||| |||||||||||||||||||| |
|
|
| T |
21598493 |
gtggtggccaagctttgaaccttggaccttgcatatattatg |
21598534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 109 - 170
Target Start/End: Complemental strand, 26409323 - 26409262
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||| || |||| |||||| ||||||| |||||||||||||| ||| |||||||||||| |
|
|
| T |
26409323 |
tggtgggcggggttcgaaccccggaccttacatatattatgcattgtccataccaactgagc |
26409262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 110 - 184
Target Start/End: Complemental strand, 27219357 - 27219281
Alignment:
| Q |
110 |
ggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||| ||||||||||||||| ||| ||||||||||| || || || | |||||||| |||||||||||||| |
|
|
| T |
27219357 |
ggtggccggggtttgaaccctggatcttacatatattatgtattgtctctgctaactgagctaagctcacgaggaca |
27219281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 122 - 184
Target Start/End: Original strand, 27721679 - 27721743
Alignment:
| Q |
122 |
ttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||| ||| ||||||||||||||||| | |||||||||||||| |||||||||||||| |
|
|
| T |
27721679 |
ttgaaccccagactttgcatatattatgcattgttcctaccaactgagctaagctcacgaggaca |
27721743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 169
Target Start/End: Complemental strand, 33654795 - 33654758
Alignment:
| Q |
132 |
gaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33654795 |
gaccttgcatatattatgcattgtccctaccaactgag |
33654758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 133 - 183
Target Start/End: Original strand, 36321509 - 36321561
Alignment:
| Q |
133 |
accttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
36321509 |
accttgcatatattatgcattgtccttaccaactgagctaagctcacgaggac |
36321561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 124 - 169
Target Start/End: Complemental strand, 43108624 - 43108579
Alignment:
| Q |
124 |
gaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
43108624 |
gaaccctgaaccttgcatatattatgcattgtccttaccaactgag |
43108579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 109 - 169
Target Start/End: Complemental strand, 1746049 - 1745989
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||| |||||||||||||||| || |||||||||||||| ||| ||| || |||||||| |
|
|
| T |
1746049 |
tggtgaccgaggtttgaacccttgatcttgcatatattatacattatctttaacaactgag |
1745989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 168
Target Start/End: Complemental strand, 3052350 - 3052290
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga |
168 |
Q |
| |
|
||||||| ||||||||||||| | |||||||||||||||| ||| ||||||||| |||| |
|
|
| T |
3052350 |
gtggtggtcgaggtttgaacctcgaaccttgcatatattatacattgtccctaccagctga |
3052290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 83
Target Start/End: Complemental strand, 4412310 - 4412274
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagg |
83 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4412310 |
tttttttgcaaatgacttggttattatgggacggagg |
4412274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 109 - 169
Target Start/End: Original strand, 5107236 - 5107296
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||| || |||| ||||| |||||||||||||||||||||| || | ||||||||||| |
|
|
| T |
5107236 |
tggtggtcggggttcgaacctcggaccttgcatatattatgcattattcataccaactgag |
5107296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 39 - 79
Target Start/End: Original strand, 5147644 - 5147684
Alignment:
| Q |
39 |
ggacaatatttttttgcaaatgactcagttattatgggacg |
79 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||| ||||| |
|
|
| T |
5147644 |
ggacaatatttttttgctaatgattcagttattataggacg |
5147684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 11099650 - 11099690
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||| ||||||||||||||| | ||||||||||| |
|
|
| T |
11099650 |
tttttttgcaattgactcagttattatagaacggagggagt |
11099690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 12611025 - 12611101
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc-agctcacgaggac |
183 |
Q |
| |
|
||||||| ||||||| |||||| |||||||||||| |||||||| ||| |||||| ||||| | ||||||||||| |
|
|
| T |
12611025 |
gtggtggtcgaggttcgaaccccagaccttgcatattttatgcattgtccataccaattgagcaaactcacgaggac |
12611101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Complemental strand, 13044485 - 13044449
Alignment:
| Q |
133 |
accttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||| |
|
|
| T |
13044485 |
accttgcatatattatgcattattcctaccaactgag |
13044449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Complemental strand, 13114483 - 13114447
Alignment:
| Q |
133 |
accttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||| |
|
|
| T |
13114483 |
accttgcatatattatgcattattcctaccaactgag |
13114447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 87
Target Start/End: Complemental strand, 13716935 - 13716903
Alignment:
| Q |
55 |
caaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
13716935 |
caaatgactccgttattatgggacggagggagt |
13716903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 19518590 - 19518634
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||| |||||||||||||| | ||||||||||||||||||| |
|
|
| T |
19518590 |
gtggtggtcgaggtttgaacccccggccttgcatatattatgcat |
19518634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 166
Target Start/End: Original strand, 20145562 - 20145618
Alignment:
| Q |
110 |
ggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaact |
166 |
Q |
| |
|
|||| |||||||| |||||| || ||||||||| |||||||| ||||||||||||| |
|
|
| T |
20145562 |
ggtgtccgaggttcgaaccccggcccttgcataaattatgcaatatccctaccaact |
20145618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 20189824 - 20189784
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||| |||| |
|
|
| T |
20189824 |
tttttttgcaaatgactcacttattatgagacggagagagt |
20189784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 184
Target Start/End: Complemental strand, 26166799 - 26166733
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| | || ||||||||||| |||||||||||||| |
|
|
| T |
26166799 |
ggtttgaaccctggaccttgcatatttgatgcattgt-ccgaccaactgagctaagctcacgaggaca |
26166733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 31280090 - 31280046
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||| |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
31280090 |
gtggtggtcgaggtttgaaccccggatattgcatatattatgcat |
31280046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 32339806 - 32339762
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||||| | || |||||| |||||||||||||||||||||| |
|
|
| T |
32339806 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcat |
32339762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 35334700 - 35334740
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
35334700 |
ttttattgaaaatgactcagttattatgggacggagagagt |
35334740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 35413027 - 35412984
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||||| |||| |||||| |||||||||||||||||||||| |
|
|
| T |
35413027 |
gtggtggccggggttcgaaccc-ggaccttgcatatattatgcat |
35412984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 35646262 - 35646302
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
35646262 |
tttttttgcaaatagctcagttattatgggatggagggagt |
35646302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 87
Target Start/End: Complemental strand, 35988567 - 35988523
Alignment:
| Q |
43 |
aatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||| ||||| |
|
|
| T |
35988567 |
aatatttttttgcaaatggatcagttattatggaacggaaggagt |
35988523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 36736811 - 36736855
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||||||||||||| ||| | |||||| ||||||||||||| |
|
|
| T |
36736811 |
gtggtggccgaggtttgagccccgaaccttgaatatattatgcat |
36736855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 39060587 - 39060627
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||| ||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
39060587 |
ttttattgaaaatgactcaattattatgggacggagggagt |
39060627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 2e-17; HSPs: 74)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 109 - 183
Target Start/End: Complemental strand, 16390499 - 16390423
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggac |
183 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
16390499 |
tggtggccgaggtttgaaccccggaccttacatatattatgcattgtccctaccaactgaggtaagctcacgaggac |
16390423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 5 - 84
Target Start/End: Complemental strand, 4552880 - 4552801
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggaggg |
84 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||||||||||||| ||| ||| ||||||||||||||| |
|
|
| T |
4552880 |
ttgtattgaaaagtgaaatgagtcaatttttctgagacaatatttttttgcaaatggctcggtttttatgggacggaggg |
4552801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 109 - 170
Target Start/End: Complemental strand, 33824951 - 33824890
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| ||| || ||||||||| |
|
|
| T |
33824951 |
tggtggccgaggtttgaaccccggaccttgcatatattatgcattgtccttatcaactgagc |
33824890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 34915982 - 34916022
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34915982 |
tttttttgcaaatgactcagttattatgggacggagggagt |
34916022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 8916464 - 8916542
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggaca |
184 |
Q |
| |
|
|||||||||||| ||||||| | ||||||||||||||||||| || ||||||||||||||| |||||||||||||| |
|
|
| T |
8916464 |
gtggtggccgagatttgaactccggaccttgcatatattatgtattgtccctaccaactgagtttagctcacgaggaca |
8916542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 29740553 - 29740475
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||| |||||||||||| ||| |||||| ||||| |||||||||||||| |
|
|
| T |
29740553 |
gtggtggccggggtttgaaccccggaccttgcgtatattatgcattgtccataccaattgagctaagctcacgaggaca |
29740475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 17151307 - 17151230
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| || || ||||||||| ||| ||||||||||||| |
|
|
| T |
17151307 |
gtggtggccgaggtttgaaccccagaccttgcatatattatgtattgtcactaccaacttagctaagctcacgaggac |
17151230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 119 - 168
Target Start/End: Complemental strand, 291427 - 291378
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga |
168 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
291427 |
ggtttgaaccccggaccttgcatatattatgcatgatccataccaactga |
291378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 8569780 - 8569719
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||||||| ||| |||||| |||| |
|
|
| T |
8569780 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccataccaattgag |
8569719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 121 - 170
Target Start/End: Original strand, 14917778 - 14917827
Alignment:
| Q |
121 |
tttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
14917778 |
tttgaaccctggtccttgcatatattatgtatcgtccctaccaactgagc |
14917827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 119 - 184
Target Start/End: Original strand, 866286 - 866353
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||| | |||||||||||||| | |||||||||||| |
|
|
| T |
866286 |
ggtttgaaccatgaaccttgcatatattatgcatcgtgcctaccaactgagctaaactcacgaggaca |
866353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 47 - 83
Target Start/End: Original strand, 9755311 - 9755347
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagg |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9755311 |
tttttttgcaaatgactcagttattatgggacggagg |
9755347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 9333802 - 9333724
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||||| ||| ||||| ||||||||||||||| |||||| ||| |||||| ||||| |||||||||||||| |
|
|
| T |
9333802 |
gtggtggccgagatttaaaccccggaccttgcatatataatgcattgtccttaccaattgagctaagctcacgaggaca |
9333724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 119 - 187
Target Start/End: Complemental strand, 20744198 - 20744128
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacagac |
187 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||| |||||||||||| |||||||||||| |||| |
|
|
| T |
20744198 |
ggtttgaaccccagaccttgcatatattatgcattgtccataccaactgagctaagctcacgaggagagac |
20744128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 28231415 - 28231493
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| || ||||||| |||||||||||||||||||||| |||||| ||||||||| ||||||| |||||| |
|
|
| T |
28231415 |
gtggtggccggagtgtgaaccccggaccttgcatatattatgcattgtccctatcaactgagccaagctcactaggaca |
28231493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 115 - 182
Target Start/End: Complemental strand, 3640581 - 3640512
Alignment:
| Q |
115 |
ccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgagga |
182 |
Q |
| |
|
|||||||| |||||| || ||||||||||| |||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
3640581 |
ccgaggttcgaaccccggcccttgcatatactatgcaatatccctaccaactgagctaagctcacgagga |
3640512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 120 - 170
Target Start/End: Complemental strand, 8639105 - 8639055
Alignment:
| Q |
120 |
gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||| |||| |||||||||||| |
|
|
| T |
8639105 |
gtttgaaccccggaccttgcatatactatgcattatccataccaactgagc |
8639055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 41 - 87
Target Start/End: Original strand, 15351548 - 15351594
Alignment:
| Q |
41 |
acaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||| |||||||| |
|
|
| T |
15351548 |
acaatatttttttgccaatgactcagttattataggactgagggagt |
15351594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 41 - 87
Target Start/End: Original strand, 15372028 - 15372074
Alignment:
| Q |
41 |
acaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||| |||||||| |
|
|
| T |
15372028 |
acaatatttttttacaaatggctcagttattatgggacagagggagt |
15372074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 109 - 184
Target Start/End: Complemental strand, 32053858 - 32053781
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||||| ||||||||| | |||||||||||||||||||| ||| |||||||||||| |||||||||||||| |
|
|
| T |
32053858 |
tggtggccggagtttgaaccacgaaccttgcatatattatgcattgtccataccaactgagctaagctcacgaggaca |
32053781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 119 - 169
Target Start/End: Original strand, 32524421 - 32524471
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||||| |||| |
|
|
| T |
32524421 |
ggtttgaaccctggactttgcatatattatgcattgtccctaccaattgag |
32524471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 2726407 - 2726468
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||| ||| |||| |||||| |||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
2726407 |
gtggtgaccggggttcgaaccccggaccttgcatatattatgcattgtccataccaactgag |
2726468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 8629686 - 8629747
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||| |||||||||||||| | |||||||||||||||||||| ||| |||||| |||| |
|
|
| T |
8629686 |
gtggtggtcgaggtttgaaccccgaaccttgcatatattatgcattgtccataccaattgag |
8629747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 119 - 168
Target Start/End: Original strand, 8637438 - 8637487
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga |
168 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8637438 |
ggtttgaacctcggaccttgcatatattatgcattgtccctaccaactga |
8637487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 8831277 - 8831217
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||| ||||||||| ||| ||||||||||| |
|
|
| T |
8831277 |
gtggtggccgaggtt-gaaccccggaccttgcataaattatgcattgtccttaccaactgag |
8831217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 119 - 152
Target Start/End: Original strand, 18253340 - 18253373
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
18253340 |
ggtttgaaccctggaccttgcatatattatgcat |
18253373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 28951470 - 28951409
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||||||||| ||| ||| |||||||||||||||||||| | | ||||||||||| |
|
|
| T |
28951470 |
gtggtggccgaggtttaaactctgaaccttgcatatattatgcattgttcataccaactgag |
28951409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 38 - 87
Target Start/End: Original strand, 33921631 - 33921680
Alignment:
| Q |
38 |
gggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||| |||||||||||||| |
|
|
| T |
33921631 |
gggacaatatttttttaaaaatggctcagttattacgggacggagggagt |
33921680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 87
Target Start/End: Original strand, 34803836 - 34803918
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||||||||| ||||| || ||||||||||||| ||| || ||||||||||||||||| |||||||| |
|
|
| T |
34803836 |
ttgtattgaaaagtgaaattggtcaatttttttggaacaatatttttttacaattggctcagttattatgggaccgagggagt |
34803918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 111 - 184
Target Start/End: Original strand, 655742 - 655817
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||| |||| |||||| |||||||||||||||||||||| || |||||||||||| ||||||| |||||| |
|
|
| T |
655742 |
gtggccggggttcgaaccccggaccttgcatatattatgcattgtcgataccaactgagctaagctcacaaggaca |
655817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 185
Target Start/End: Complemental strand, 788937 - 788858
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggacag |
185 |
Q |
| |
|
||||||| || ||||||||| | | |||||||||||||||||||| ||| ||||||||||| ||||||||||||||| |
|
|
| T |
788937 |
gtggtggtcggggtttgaactccgaaccttgcatatattatgcattgtccttaccaactgagataagctcacgaggacag |
788858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 33109309 - 33109269
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33109309 |
tttttttgcaaatagctcagttattatgggacggagggagt |
33109269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 111 - 183
Target Start/End: Original strand, 331879 - 331953
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggac |
183 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||| || |||||||||||| ||||||||||||| |
|
|
| T |
331879 |
gtggccgaggtttgaatcccaaaccttgcatatattatgcattgtctctaccaactgagttaagctcacgaggac |
331953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 119 - 187
Target Start/End: Complemental strand, 9977117 - 9977047
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggacagac |
187 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||| |||||| |||| |||||| |||||||||| |
|
|
| T |
9977117 |
ggtttgaaccccagaccttgcatatattatgcattatccataccaattgagttaagctcaggaggacagac |
9977047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 119 - 170
Target Start/End: Original strand, 14918301 - 14918352
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
14918301 |
ggtttgaaccccagaccttgtatatattatgcattgtccctaccaactgagc |
14918352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 21847265 - 21847187
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| | || |||||| | ||||||||||||||||| || |||||||||||||||| |||||| ||||||| |
|
|
| T |
21847265 |
gtggtggccgggattcgaaccccgtaccttgcatatattatgtattgtccctaccaactgagctaagctcaagaggaca |
21847187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 167
Target Start/End: Complemental strand, 24248236 - 24248177
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactg |
167 |
Q |
| |
|
||||||| ||||| |||||||| ||||||| ||||||||||| || |||| ||||||||| |
|
|
| T |
24248236 |
gtggtggtcgagggttgaaccccggaccttacatatattatgtattatccttaccaactg |
24248177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 111 - 170
Target Start/End: Original strand, 26356074 - 26356133
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||| |||||||||| | |||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
26356074 |
gtggccggagtttgaaccccgaaccttgcatatattatgcattgtcccaaccaactgagc |
26356133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 27907941 - 27908019
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| |||||||| |||| | ||||||||| |||| ||||||||| |
|
|
| T |
27907941 |
gtggtggccggggtttgaaccccagaccttgcatattttatgcattatccttgtcaactgagctaagctaacgaggaca |
27908019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 119 - 170
Target Start/End: Original strand, 30960054 - 30960105
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||| ||| |||||||||||| |
|
|
| T |
30960054 |
ggttcgaaccctggaccttgcatatattaagcattgtccttaccaactgagc |
30960105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 109 - 152
Target Start/End: Complemental strand, 34474297 - 34474254
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||||| |||| ||||| ||||||||||||||||||||||| |
|
|
| T |
34474297 |
tggtggccggggttcgaaccatggaccttgcatatattatgcat |
34474254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 183
Target Start/End: Complemental strand, 247730 - 247654
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||||||| |||||||| | |||||||||| ||| ||||||||||||| |
|
|
| T |
247730 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac |
247654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 4455586 - 4455648
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||| || ||||||||||| ||||||||||||||||||| | ||| |||||||||||| |
|
|
| T |
4455586 |
gtggtggtcggggtttgaaccccagaccttgcatatattatgccttgtccataccaactgagc |
4455648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 124 - 170
Target Start/End: Complemental strand, 7414387 - 7414341
Alignment:
| Q |
124 |
gaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||| ||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
7414387 |
gaaccctggcccttgcatataatatgcaatatccctaccaactgagc |
7414341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 111 - 157
Target Start/End: Original strand, 8393745 - 8393791
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatattatgcatcatcc |
157 |
Q |
| |
|
||||||| |||||||| |||||||||||||||| |||||||| |||| |
|
|
| T |
8393745 |
gtggccggggtttgaaacctggaccttgcatattttatgcattatcc |
8393791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 10018470 - 10018409
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||| |||||||||| | ||||| |||||||||||||| || |||||||||||||| |
|
|
| T |
10018470 |
gtggtggccggagtttgaaccccgaaccttacatatattatgcattat-cctaccaactgagc |
10018409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 87
Target Start/End: Original strand, 15321357 - 15321436
Alignment:
| Q |
8 |
tattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||| ||||||||| |||| ||||||||||| |||||||||| ||||| ||||||| |||| |||||||| |
|
|
| T |
15321357 |
tattgaaacgtgaaatgaatcaatatttctgggacaatattgttttgcaaataactcaattattataggactgagggagt |
15321436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 121 - 183
Target Start/End: Original strand, 21029369 - 21029434
Alignment:
| Q |
121 |
tttgaaccctggaccttgcatatattatgca-tcatccctaccaactgag--cagctcacgaggac |
183 |
Q |
| |
|
||||||||| | ||||||||||||||||||| | ||||||||||||||| |||||||||||||| |
|
|
| T |
21029369 |
tttgaaccccgaaccttgcatatattatgcatttgtccctaccaactgagctcagctcacgaggac |
21029434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 132 - 170
Target Start/End: Original strand, 30639440 - 30639478
Alignment:
| Q |
132 |
gaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
30639440 |
gaccttgcatatattatgcattattcctaccaactgagc |
30639478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 169
Target Start/End: Complemental strand, 31971589 - 31971539
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
31971589 |
ggtttgaacctcggaccttgcatatattatgcattgtccttaccaactgag |
31971539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 112 - 183
Target Start/End: Complemental strand, 33976311 - 33976239
Alignment:
| Q |
112 |
tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||| |||||||| | |||||||||| ||| ||||||||||||| |
|
|
| T |
33976311 |
tggccggggtttgaaccccggaccttgcatattttatgcattgt-cctaccaactaagctaagctcacgaggac |
33976239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 4467349 - 4467288
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||| |||||| ||| |||||| |||| |
|
|
| T |
4467349 |
gtggtggccgaggtttgagccccagaccttgcatatatcatgcattgtccttaccaattgag |
4467288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 149
Target Start/End: Original strand, 10507518 - 10507559
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatg |
149 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
10507518 |
gtggtggccgatgtttgaaccccagaccttgcatatattatg |
10507559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 134 - 180
Target Start/End: Original strand, 10780123 - 10780171
Alignment:
| Q |
134 |
ccttgcatatattatgcatcatccctaccaactgagc--agctcacgag |
180 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
10780123 |
ccttgcatatattatgcattgtccctaccaactgagctaagctcacgag |
10780171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 121 - 183
Target Start/End: Complemental strand, 18256940 - 18256877
Alignment:
| Q |
121 |
tttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggac |
183 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||| || ||||||||| ||||||||||||| |
|
|
| T |
18256940 |
tttgaaccc-ggaccttgcatatattatgcattgtccttatcaactgagctaagctcacgaggac |
18256877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 24373700 - 24373761
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||| | ||||||||||| ||||||||||||||||||||| || ||||||| |||| |
|
|
| T |
24373700 |
gtggtggctggggtttgaacccctgaccttgcatatattatgcattgtctctaccaattgag |
24373761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 120 - 169
Target Start/End: Complemental strand, 29283874 - 29283825
Alignment:
| Q |
120 |
gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||| || |||||||||||| |
|
|
| T |
29283874 |
gtttgaaccctagaccttgcatatattatacattgtctctaccaactgag |
29283825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 39 - 75
Target Start/End: Complemental strand, 2657844 - 2657808
Alignment:
| Q |
39 |
ggacaatatttttttgcaaatgactcagttattatgg |
75 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
2657844 |
ggacaatatttttttacaaataactcagttattatgg |
2657808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 4450333 - 4450289
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||| ||||| || |||||| |||||||||||||||||||||| |
|
|
| T |
4450333 |
gtggtgaccgagattcgaaccccggaccttgcatatattatgcat |
4450289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 184
Target Start/End: Complemental strand, 9111107 - 9111040
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||| | | |||||||||| | |||||||||||||| |
|
|
| T |
9111107 |
ggttcgaaccccggaccttgcatatattatgcattgttcataccaactgaactaagctcacgaggaca |
9111040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 12184579 - 12184535
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||||| | |||||||| |||||||||||||||||||||| |
|
|
| T |
12184579 |
gtggtggccgggatttgaaccacggaccttgcatatattatgcat |
12184535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 112 - 152
Target Start/End: Complemental strand, 12215820 - 12215780
Alignment:
| Q |
112 |
tggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||| | ||||||||| |||||||||||||||||||||| |
|
|
| T |
12215820 |
tggccgtgatttgaaccccggaccttgcatatattatgcat |
12215780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 184
Target Start/End: Original strand, 12333569 - 12333636
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||| ||| ||||||||||||||| |||||||| ||| ||| |||||||| |||||||||||||| |
|
|
| T |
12333569 |
ggtttaaactctggaccttgcatattttatgcattgtccatactaactgagctaagctcacgaggaca |
12333636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 148
Target Start/End: Complemental strand, 12440734 - 12440694
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattat |
148 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
12440734 |
gtggtggtcgaggtttgaaccccagaccttgcatatattat |
12440694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 12700411 - 12700455
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
|||||||||| |||| |||||| ||||||||||||||||||||| |
|
|
| T |
12700411 |
gtggtggccggggttcaaaccctagaccttgcatatattatgcat |
12700455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 121 - 169
Target Start/End: Original strand, 14429131 - 14429179
Alignment:
| Q |
121 |
tttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||||| ||||||||||||| ||||| || ||||| |||||||||| |
|
|
| T |
14429131 |
tttgaaccccggaccttgcatattttatgtattatcccaaccaactgag |
14429179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 82
Target Start/End: Complemental strand, 15081368 - 15081324
Alignment:
| Q |
38 |
gggacaatatttttttgcaaatgactcagttattatgggacggag |
82 |
Q |
| |
|
|||||| | |||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
15081368 |
gggacacttttttttcgcagatgactcagttattatgggacggag |
15081324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 15155806 - 15155762
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||| || ||||||||||| ||||||||||||||||||||| |
|
|
| T |
15155806 |
gtggtggtcgtggtttgaaccccagaccttgcatatattatgcat |
15155762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 15187134 - 15187090
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||| || |||||||||| |||||||||||||||||||||| |
|
|
| T |
15187134 |
gtggtggtcggggtttgaacctcggaccttgcatatattatgcat |
15187090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 15473472 - 15473516
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||| || |||||||||| |||||||||||||||||||||| |
|
|
| T |
15473472 |
gtggtggtcggggtttgaacctcggaccttgcatatattatgcat |
15473516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 111 - 184
Target Start/End: Complemental strand, 21296825 - 21296751
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||| | |||||||| |||||||||||||| |||||||| |||| ||||||||||| | |||||||||||| |
|
|
| T |
21296825 |
gtggccgggatttgaacc-tggaccttgcatattttatgcattgtcccaaccaactgagctaaactcacgaggaca |
21296751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 166
Target Start/End: Complemental strand, 28898925 - 28898869
Alignment:
| Q |
110 |
ggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaact |
166 |
Q |
| |
|
|||||||| ||||||||| | ||||||| |||||||||||||| ||| |||||||| |
|
|
| T |
28898925 |
ggtggccggggtttgaactccggacctttcatatattatgcattgtccttaccaact |
28898869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Original strand, 30064119 - 30064159
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||||| |
|
|
| T |
30064119 |
tttttttgcaattgactcaattattatgggacggaaggagt |
30064159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 168
Target Start/End: Complemental strand, 34701218 - 34701158
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactga |
168 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||| | |||||||||||| |
|
|
| T |
34701218 |
gtggtggccggagtttgaacctcagaccttgcatatattatgcattgttcctaccaactga |
34701158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0027 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 61560 - 61621
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||| ||||||||| |||| ||||||||||| |
|
|
| T |
61560 |
gtggtggccggggtttgaaccctggaccttacatacattatgcattatccttaccaactgag |
61621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 3)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 5 - 83
Target Start/End: Complemental strand, 158005 - 157927
Alignment:
| Q |
5 |
ttgtattgaaaagtgaaatgagtcaannnnnnngggacaatatttttttgcaaatgactcagttattatgggacggagg |
83 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
158005 |
ttgtattgaaaagtgaaatgggtcaatttttttttgacaatatttttttgcaaatgactcagttattataggacggagg |
157927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 221003 - 221065
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
||||||| || |||||||||||| ||| |||||||||||||| || ||||||||||||||||| |
|
|
| T |
221003 |
gtggtggtcggggtttgaaccctagactttgcatatattatgtattatccctaccaactgagc |
221065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 50 - 87
Target Start/End: Complemental strand, 230189 - 230152
Alignment:
| Q |
50 |
ttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
230189 |
ttttacaaatgactcggttattatgggacggagggagt |
230152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0155 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0155
Description:
Target: scaffold0155; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 40 - 87
Target Start/End: Original strand, 8117 - 8164
Alignment:
| Q |
40 |
gacaatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
8117 |
gacaatattttttaacaattgactcagttattatgggacggagggagt |
8164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 184
Target Start/End: Original strand, 31912 - 31990
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||||| || ||||||| |||||||||||||||||||||| |||||| ||||||||| ||||||| |||||| |
|
|
| T |
31912 |
gtggtggccggagtgtgaaccccggaccttgcatatattatgcattgtccctatcaactgagccaagctcactaggaca |
31990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0247 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0247
Description:
Target: scaffold0247; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 120 - 170
Target Start/End: Original strand, 20989 - 21039
Alignment:
| Q |
120 |
gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||| |||||||||| ||||||||| ||| ||||||||||||||||| |
|
|
| T |
20989 |
gtttgaactctggaccttgtatatattatccattatccctaccaactgagc |
21039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0238 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0238
Description:
Target: scaffold0238; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 119 - 169
Target Start/End: Complemental strand, 25449 - 25399
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
25449 |
ggttcgaaccctggaccttgcatatattatgcattgtccttaccaactgag |
25399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 75396 - 75334
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||||| | || |||||| |||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
75396 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattgtccttaccaactgagc |
75334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 109 - 184
Target Start/End: Complemental strand, 185333 - 185256
Alignment:
| Q |
109 |
tggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||| ||| ||||||||||| ||| ||||||||| |||||||| ||| |||||||||||| |||||||||||||| |
|
|
| T |
185333 |
tggtgaccggggtttgaaccccggatcttgcatattttatgcattgtccataccaactgagctaagctcacgaggaca |
185256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0126 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0126
Description:
Target: scaffold0126; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 124 - 169
Target Start/End: Original strand, 34894 - 34939
Alignment:
| Q |
124 |
gaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
34894 |
gaaccctggaccttgcatatattatgcattgtccttaccaactgag |
34939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1149 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold1149
Description:
Target: scaffold1149; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 111 - 184
Target Start/End: Complemental strand, 2400 - 2325
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||| ||||||||||| |||| ||||||||| |||| |
|
|
| T |
2400 |
gtggctgaggtttgaaccccaaaccttgcatatattatgcattgtccctaccaaccgagctaagctcacgacgaca |
2325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0983 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0983
Description:
Target: scaffold0983; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 111 - 184
Target Start/End: Original strand, 3308 - 3383
Alignment:
| Q |
111 |
gtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||| | ||| |||||||||||| ||||||||||||| |
|
|
| T |
3308 |
gtggccgaggtttgaaccccgaaccttgcatatattatgtcttgtccttaccaactgagctatgctcacgaggaca |
3383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0034 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0034
Description:
Target: scaffold0034; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 48 - 80
Target Start/End: Complemental strand, 97994 - 97962
Alignment:
| Q |
48 |
ttttttgcaaatgactcagttattatgggacgg |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
97994 |
ttttttgcaaatgactcagttattatgggacgg |
97962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 152
Target Start/End: Original strand, 72777 - 72809
Alignment:
| Q |
120 |
gtttgaaccctggaccttgcatatattatgcat |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
72777 |
gtttgaaccctggaccttgcatatattatgcat |
72809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0040 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0040
Description:
Target: scaffold0040; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 56854 - 56777
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggaca |
184 |
Q |
| |
|
|||||||| | |||||||| | ||||||||||||||||||| ||| ||| |||||||||||| |||||||||||||| |
|
|
| T |
56854 |
gtggtggctggggtttgaaac-tggaccttgcatatattatacattgtccataccaactgagctaagctcacgaggaca |
56777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 56 - 87
Target Start/End: Complemental strand, 394704 - 394673
Alignment:
| Q |
56 |
aaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
394704 |
aaatgactcagttattatgggacggagggagt |
394673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1127 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold1127
Description:
Target: scaffold1127; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 165
Target Start/End: Original strand, 1166 - 1212
Alignment:
| Q |
119 |
ggtttgaaccctggaccttgcatatattatgcatcatccctaccaac |
165 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| | ||||||||| |
|
|
| T |
1166 |
ggtttgaaccccggaccttgcatatattatgcattgttcctaccaac |
1212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0735 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0735
Description:
Target: scaffold0735; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 1599 - 1537
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||| | |||| |||||| ||||||||||||| |||||||| ||| |||||||||||| |
|
|
| T |
1599 |
gtggtggcgggggttcgaaccccggaccttgcatattttatgcattgtccataccaactgagc |
1537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0180 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0180
Description:
Target: scaffold0180; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 170
Target Start/End: Complemental strand, 17802 - 17741
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||||| | ||||||||||| ||||||||||| |||||||||| ||| |||||||||||| |
|
|
| T |
17802 |
gtggtggctggggtttgaaccc-ggaccttgcatgtattatgcattgtccataccaactgagc |
17741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0118 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0118
Description:
Target: scaffold0118; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 186
Target Start/End: Complemental strand, 40062 - 39989
Alignment:
| Q |
115 |
ccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc--agctcacgaggacaga |
186 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||| |||||||||||| |||||||||| ||||| |
|
|
| T |
40062 |
ccgaggtttgaacctctaaccttgcatatattatgcattgtccataccaactgagctaagctcacgagcacaga |
39989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 120 - 183
Target Start/End: Complemental strand, 99096 - 99031
Alignment:
| Q |
120 |
gtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag--cagctcacgaggac |
183 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||| |||||||| ||||||||||||| |
|
|
| T |
99096 |
gtttgaaccccagaccttgcatatattatgcattgtccctatcaactgagtcaagctcacgaggac |
99031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 112 - 170
Target Start/End: Complemental strand, 239874 - 239816
Alignment:
| Q |
112 |
tggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgagc |
170 |
Q |
| |
|
|||||| ||||||||| | |||| ||||||||||||||||| ||| |||||||||||| |
|
|
| T |
239874 |
tggccggggtttgaactccggactttgcatatattatgcattgtccttaccaactgagc |
239816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0143 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0143
Description:
Target: scaffold0143; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 121 - 166
Target Start/End: Complemental strand, 4524 - 4479
Alignment:
| Q |
121 |
tttgaaccctggaccttgcatatattatgcatcatccctaccaact |
166 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||| ||||| |
|
|
| T |
4524 |
tttgaaccctggaccttgcataaattatgcattgtccctatcaact |
4479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 53370 - 53431
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||| || ||||||||||| |||||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
53370 |
gtggtggtcggggtttgaaccccagaccttgcatattttatgcattgtcccttccaactgag |
53431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 161212 - 161151
Alignment:
| Q |
108 |
gtggtggccgaggtttgaaccctggaccttgcatatattatgcatcatccctaccaactgag |
169 |
Q |
| |
|
||||||| || ||||||||||| | ||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
161212 |
gtggtggtcggggtttgaaccccgaaccttgcatattttatgcattgtccataccaactgag |
161151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0045
Description:
Target: scaffold0045; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 26259 - 26219
Alignment:
| Q |
47 |
tttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26259 |
tttttttgcaaattgttcagttattatgggacggagggagt |
26219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 87
Target Start/End: Original strand, 98822 - 98866
Alignment:
| Q |
43 |
aatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||| |||| |||||||| |||||||||||||||||||| |||| |
|
|
| T |
98822 |
aatatattttagcaaatgattcagttattatgggacggagtgagt |
98866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 87
Target Start/End: Original strand, 108100 - 108144
Alignment:
| Q |
43 |
aatatttttttgcaaatgactcagttattatgggacggagggagt |
87 |
Q |
| |
|
||||| |||| |||||||| |||||||||||||||||||| |||| |
|
|
| T |
108100 |
aatatattttagcaaatgattcagttattatgggacggagtgagt |
108144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University