View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9379_high_25 (Length: 227)
Name: NF9379_high_25
Description: NF9379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9379_high_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 138
Target Start/End: Original strand, 24932116 - 24932253
Alignment:
| Q |
1 |
ttatgtgtgggtgctacacagaaattaatatctttagagctctaaccgtgggagggttcccgtgccctcgacatatccaagatataattttcttgacttt |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24932116 |
ttatgtatgggtgctacacagaaattaatatctttagagctctaaccgtgggagggttcccgtgccctcgacatatccaagatataattttcttgacttt |
24932215 |
T |
 |
| Q |
101 |
cggctagcttgtccatccggtcatcattatctgttttt |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24932216 |
cggctagcttgtccatccggtcatcattatctgttttt |
24932253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 142 - 220
Target Start/End: Original strand, 24932365 - 24932443
Alignment:
| Q |
142 |
tactggcagcaaagttgtccttatgtcttgtacactttgatcctgatttgctcctttgtcaacattttcttctctgctt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24932365 |
tactggcagcaaagttgtccttatgtcttgtacactttgatcctgatttgctactttgtcaacattttcttctctgctt |
24932443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University