View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9379_low_26 (Length: 364)
Name: NF9379_low_26
Description: NF9379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9379_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 341; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 1 - 345
Target Start/End: Original strand, 38367515 - 38367859
Alignment:
| Q |
1 |
gaaggaaatgtgataaacttgcaattcatatacatcatctttcaagcctcccaaatacaatgacactctcttcaagcaccacaactatgtggcgaggatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38367515 |
gaaggaaatgtgataaacttgcaattcatatacatcatctttcaagcctcccaaatacaatgacactctcttcaagcaccacgactatgtggcgaggatc |
38367614 |
T |
 |
| Q |
101 |
cgatgaggacgaatccagcaaccagtttgccgaaccaataagatggaagaaattcgcgcatgtgtgcacctcagtggtcaagtatgaccccaactggttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38367615 |
cgatgaggacgaatccagcaaccagtttgccgaaccaataagatggaagaaattcgcgcatgtgtgcacctcagtggtcaagtatgaccccaactggttg |
38367714 |
T |
 |
| Q |
201 |
cacgaatcaaattcaagcggggtttatatcgtaaccggtgctcaactcatcagcaaagggaattggcctaggaatgtacttcacctgcgccttctcttca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38367715 |
cacgaatcaaattcaagcggggtttatatcgtaaccggtgctcaactcatcagcaaagggaattggcctaggaatgtacttcacctgcgccttctcttca |
38367814 |
T |
 |
| Q |
301 |
ctcacataccaaattgcagcatcaggaaaacagaatgggctgctg |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38367815 |
ctcacataccaaattgcagcatcaggaaaacagaatgggctgctg |
38367859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University