View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9379_low_45 (Length: 270)
Name: NF9379_low_45
Description: NF9379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9379_low_45 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 71 - 257
Target Start/End: Complemental strand, 6082103 - 6081917
Alignment:
| Q |
71 |
acatgaccttctaagaatgaagttgaagattcataagtttaggtgcaagaaatggttagttagaacatagaagttgagaaagtaaagagaacaatgaata |
170 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6082103 |
acatgaccttctaagaatgaagttgaaggttgataagtttaggtgcaagaaatggttagttagaacatagaagttgagaaagtgaagagaacaatgaata |
6082004 |
T |
 |
| Q |
171 |
tgataacgtgttgtgcttgatatctcaccgacgctctgagttcaaggaaaatgactcacactcctcaactaacaactatctctgctt |
257 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6082003 |
tgataacgtgttgtgtttgatatctcaccgacgctctgagttcaaggaaaatgactcacactcctcaactaacaactatctctgctt |
6081917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University