View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9379_low_53 (Length: 250)
Name: NF9379_low_53
Description: NF9379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9379_low_53 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 19 - 240
Target Start/End: Complemental strand, 7108955 - 7108734
Alignment:
| Q |
19 |
cttttggaggtaatcttgcccttaaaatagacatttataaagcttttgacactgtggaatgaaaatttcttttgaagattttgaaagcttttggttttaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7108955 |
cttttggaggtaatcttgcccttaaaatagacatttataaagcttttgacactgtggaatgaaaatttcttttgaagattttgaaagcttttggttttaa |
7108856 |
T |
|
| Q |
119 |
tgaaaacatttgtaattggatagaggtcattttaaactcatattctctgataatttctctcaatgataagcttcatgattattttcattgtaagagaggg |
218 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7108855 |
tgaaaacatttggaattggatagaggtcattttaaactcatattgtctgataatttctctcaatgataagcttcatgattattttcattgtaagagaggg |
7108756 |
T |
|
| Q |
219 |
gtgaggcaggaatactgtatct |
240 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
7108755 |
gtgaggcaggaatactgtatct |
7108734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University