View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9379_low_55 (Length: 246)
Name: NF9379_low_55
Description: NF9379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9379_low_55 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 12 - 238
Target Start/End: Complemental strand, 35721987 - 35721765
Alignment:
| Q |
12 |
agttgtgactatagtctcttcactcttggatttataggttaaatttatgtgcatttactattttttggtataattgtgtttactatatatgaagtaagca |
111 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35721987 |
agttgtgactatactcccttcactcttggatttataggttaaatttatgtacatttactattttttggtataattgtgtttactat----gaagtaagca |
35721892 |
T |
 |
| Q |
112 |
ttgacccctaagttaggatataataaatcaatcatttaaatccagttacgagcataacttttaaaataaatttgccccaaacnnnnnnncttattacttc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| |||||| ||| |
|
|
| T |
35721891 |
ttgacccctaagttaggatataataaatcaatcatttaaatccatttacgagcataacttttaaaataaatttaccccaaactttttttcttattctttc |
35721792 |
T |
 |
| Q |
212 |
ataacaaataaaataattacaacacga |
238 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
35721791 |
ataacaaataaaataattacaatacga |
35721765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University