View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9379_low_57 (Length: 246)

Name: NF9379_low_57
Description: NF9379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9379_low_57
NF9379_low_57
[»] chr7 (1 HSPs)
chr7 (12-238)||(35721765-35721987)


Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 12 - 238
Target Start/End: Complemental strand, 35721987 - 35721765
Alignment:
12 agttgtgactatagtctcttcactcttggatttataggttaaatttatgtgcatttactattttttggtataattgtgtttactatatatgaagtaagca 111  Q
    ||||||||||||| || ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    ||||||||||    
35721987 agttgtgactatactcccttcactcttggatttataggttaaatttatgtacatttactattttttggtataattgtgtttactat----gaagtaagca 35721892  T
112 ttgacccctaagttaggatataataaatcaatcatttaaatccagttacgagcataacttttaaaataaatttgccccaaacnnnnnnncttattacttc 211  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||       ||||||  |||    
35721891 ttgacccctaagttaggatataataaatcaatcatttaaatccatttacgagcataacttttaaaataaatttaccccaaactttttttcttattctttc 35721792  T
212 ataacaaataaaataattacaacacga 238  Q
    |||||||||||||||||||||| ||||    
35721791 ataacaaataaaataattacaatacga 35721765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University