View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9379_low_72 (Length: 215)
Name: NF9379_low_72
Description: NF9379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9379_low_72 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 11 - 198
Target Start/End: Complemental strand, 33659171 - 33658984
Alignment:
| Q |
11 |
agattatacttgccatcctcagactttccaatattacctacaatacaagatcttgatgagaaatattttcatgaagttgctttcaatataaaacaatagt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
33659171 |
agattatacttgccatcctcagactttccaatattacctacaatacaagatcttgatgagaaatattttgatgaagttgctttcaacataaaacaatagt |
33659072 |
T |
|
| Q |
111 |
agtgtgtgtgtatcatagcataccctatgagtaataggcatatttctagtttgaccccaactcaatggcatcttccctccttcattgg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33659071 |
agtgtgtgtgtatcatagcataccctatgagtaataggcatatttctagtttgaccccaactcaatggcatcttccctccttcattgg |
33658984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University