View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9380_low_10 (Length: 239)
Name: NF9380_low_10
Description: NF9380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9380_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 10 - 220
Target Start/End: Complemental strand, 35318537 - 35318329
Alignment:
| Q |
10 |
tttggaggtggaggaccatttgttttgtatttataaatttttcggcttggtgtgataccttattttcaaatggatgggaaggggtgtgattttcccggga |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35318537 |
tttggaggtggaggaccatttgttttgtatttataaattttccggcttgatgtgataccttattttcaaatggatggga-ggggtgtgattttcccggga |
35318439 |
T |
 |
| Q |
110 |
ctattacctctcttttggacacctttgcttcctcctcgtcaagtaacaagcatctgaaaggtttaatgctaagtataacacacaaccgtttggaagatac |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| ||||||||| |||||||||||| |
|
|
| T |
35318438 |
ctattacctctcttttggacacctttgcttcctcctcgtcaagtaacaagcatccgaaaggtttaatgctaa-tatagcacacaaccatttggaagatac |
35318340 |
T |
 |
| Q |
210 |
gggaggcaaga |
220 |
Q |
| |
|
|||||||||| |
|
|
| T |
35318339 |
aggaggcaaga |
35318329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University