View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9381_high_21 (Length: 246)
Name: NF9381_high_21
Description: NF9381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9381_high_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 15196853 - 15197078
Alignment:
| Q |
1 |
gtcatctttgtactcaatcttaagtgttttcaatattac----ctttaactgaggtcatttctacttggcgaggtggaaatgaatgaatttatgaaggcg |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||| || ||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15196853 |
gtcatctttgtactcaatcttaagtgttttgaatattacgtacctttgacagaggtcatttcgacttggcgaggtggaaatgaatgaatttatgaaggcg |
15196952 |
T |
 |
| Q |
97 |
tggaaccccatatttatagagcataccatatgtatgtcgtgagttatgctaattaaagttatactctaggtgtaactgaagcgtcttaattatgcaaaaa |
196 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
15196953 |
tggaacctcatatttatagagcataccatatgtatgtcgtgagttatgcaaattaaagttatactctaggtctaactgaagcatcttaattatgcaaaaa |
15197052 |
T |
 |
| Q |
197 |
tactctttacttcgtatagatataat |
222 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
15197053 |
tactctttacttcgtatagatataat |
15197078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University