View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9381_high_28 (Length: 228)
Name: NF9381_high_28
Description: NF9381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9381_high_28 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 18270167 - 18269940
Alignment:
| Q |
1 |
cctatgccgtctaaataaaggggatagggcttcagtcctattgttaaacaagataacaagggaaagctaaattaagacagactaaccttgctgcatagct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18270167 |
cctatgccgtctaaataaaggggatagggcttcagtcctattgttaaacaagataacaagggaaagctaaattaagacagactaaccttgctgcatagct |
18270068 |
T |
 |
| Q |
101 |
ctgttgcagttttcttattctccacttcctcaactacttttatcgcttctagccaccatgattcactgtagttgtcttcaacagtgtcttcatattgcag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18270067 |
ctgttgcagttttcttattctccacttcctcaactacttttatcgcttctagccaccatgaatcactgtagttgtcttcaacagtgtcttcatattgcag |
18269968 |
T |
 |
| Q |
201 |
aaaattgggcttgttatcattaggttga |
228 |
Q |
| |
|
||||||||||||||||||||| |||||| |
|
|
| T |
18269967 |
aaaattgggcttgttatcattcggttga |
18269940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University