View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9381_low_2 (Length: 624)
Name: NF9381_low_2
Description: NF9381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9381_low_2 |
 |  |
|
| [»] scaffold0031 (2 HSPs) |
 |  |  |
|
| [»] scaffold0118 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0031 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 137 - 190
Target Start/End: Complemental strand, 124396 - 124343
Alignment:
| Q |
137 |
gtgtttaatttgctgagttgaatataacacttatgaatttgaattcaaattcga |
190 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
124396 |
gtgtttaatttgctgagttgaatataaaacttatgaattcaaattcaaattcga |
124343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031; HSP #2
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 26 - 91
Target Start/End: Complemental strand, 124505 - 124440
Alignment:
| Q |
26 |
gaaggtgttgctgggttctcaagttttgtgcttaatgattcgttgaattttggtttgttgctagat |
91 |
Q |
| |
|
|||| |||||||||||||||| ||||||| |||| |||||| ||||||||| || |||||||||| |
|
|
| T |
124505 |
gaagatgttgctgggttctcatgttttgttcttagtgattcattgaatttttgtacgttgctagat |
124440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 557 - 602
Target Start/End: Complemental strand, 7310508 - 7310463
Alignment:
| Q |
557 |
gatgatgttgctgttgaattgatgacgatgttgttgctgctattgt |
602 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
7310508 |
gatgatgttgctgttgaattgatgatgttgttgttgctgctattgt |
7310463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000006; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 535 - 610
Target Start/End: Complemental strand, 11316331 - 11316257
Alignment:
| Q |
535 |
atggttcattttgataactagtgatgatgttgctgttgaattgatgacgatgttgttgctgctattgtataatctg |
610 |
Q |
| |
|
|||||| ||||||||| | |||||||||||| |||||||||||||| | |||||||| ||||||||| ||||||| |
|
|
| T |
11316331 |
atggtttattttgatagatggtgatgatgttgttgttgaattgatgatgttgttgttg-tgctattgtttaatctg |
11316257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 542 - 592
Target Start/End: Original strand, 32470300 - 32470350
Alignment:
| Q |
542 |
attttgataactagtgatgatgttgctgttgaattgatgacgatgttgttg |
592 |
Q |
| |
|
||||||||| | |||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
32470300 |
attttgatagatggtgatgatgttgttgttgaattgatgatgatgttgttg |
32470350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000009; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 252 - 305
Target Start/End: Complemental strand, 22552254 - 22552201
Alignment:
| Q |
252 |
ggcgttggggttacgactgcgactgcagcgtttgttgcggtggttggaagggga |
305 |
Q |
| |
|
|||||||||||||||||| |||| | |||||||||||||||||||||||||| |
|
|
| T |
22552254 |
ggcgttggggttacgactacgacgacgacgtttgttgcggtggttggaagggga |
22552201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 555 - 592
Target Start/End: Complemental strand, 32694301 - 32694264
Alignment:
| Q |
555 |
gtgatgatgttgctgttgaattgatgacgatgttgttg |
592 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32694301 |
gtgatgatgttgctgttgaattgatgatgatgttgttg |
32694264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 555 - 592
Target Start/End: Complemental strand, 32797528 - 32797491
Alignment:
| Q |
555 |
gtgatgatgttgctgttgaattgatgacgatgttgttg |
592 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32797528 |
gtgatgatgttgctgttgaattgatgatgatgttgttg |
32797491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 555 - 592
Target Start/End: Complemental strand, 30858285 - 30858248
Alignment:
| Q |
555 |
gtgatgatgttgctgttgaattgatgacgatgttgttg |
592 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30858285 |
gtgatgatgttgctgttgaattgatgatgatgttgttg |
30858248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 557 - 602
Target Start/End: Complemental strand, 38241291 - 38241246
Alignment:
| Q |
557 |
gatgatgttgctgttgaattgatgacgatgttgttgctgctattgt |
602 |
Q |
| |
|
|||||||||| |||||||||||||| | |||||||||||||||||| |
|
|
| T |
38241291 |
gatgatgttgttgttgaattgatgatgttgttgttgctgctattgt |
38241246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0118 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0118
Description:
Target: scaffold0118; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 555 - 592
Target Start/End: Complemental strand, 42683 - 42646
Alignment:
| Q |
555 |
gtgatgatgttgctgttgaattgatgacgatgttgttg |
592 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
42683 |
gtgatgatgttgttgttgaattgatgatgatgttgttg |
42646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 426 - 454
Target Start/End: Complemental strand, 33962337 - 33962309
Alignment:
| Q |
426 |
aaaaaatgggggagattgcagcatttgtt |
454 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33962337 |
aaaaaatgggggagattgcagcatttgtt |
33962309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University