View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9381_low_2 (Length: 624)

Name: NF9381_low_2
Description: NF9381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9381_low_2
NF9381_low_2
[»] scaffold0031 (2 HSPs)
scaffold0031 (137-190)||(124343-124396)
scaffold0031 (26-91)||(124440-124505)
[»] chr6 (1 HSPs)
chr6 (557-602)||(7310463-7310508)
[»] chr2 (2 HSPs)
chr2 (535-610)||(11316257-11316331)
chr2 (542-592)||(32470300-32470350)
[»] chr8 (3 HSPs)
chr8 (252-305)||(22552201-22552254)
chr8 (555-592)||(32694264-32694301)
chr8 (555-592)||(32797491-32797528)
[»] chr5 (1 HSPs)
chr5 (555-592)||(30858248-30858285)
[»] chr3 (1 HSPs)
chr3 (557-602)||(38241246-38241291)
[»] scaffold0118 (1 HSPs)
scaffold0118 (555-592)||(42646-42683)
[»] chr4 (1 HSPs)
chr4 (426-454)||(33962309-33962337)


Alignment Details
Target: scaffold0031 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0031
Description:

Target: scaffold0031; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 137 - 190
Target Start/End: Complemental strand, 124396 - 124343
Alignment:
137 gtgtttaatttgctgagttgaatataacacttatgaatttgaattcaaattcga 190  Q
    ||||||||||||||||||||||||||| |||||||||||  |||||||||||||    
124396 gtgtttaatttgctgagttgaatataaaacttatgaattcaaattcaaattcga 124343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0031; HSP #2
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 26 - 91
Target Start/End: Complemental strand, 124505 - 124440
Alignment:
26 gaaggtgttgctgggttctcaagttttgtgcttaatgattcgttgaattttggtttgttgctagat 91  Q
    |||| |||||||||||||||| ||||||| |||| |||||| ||||||||| ||  ||||||||||    
124505 gaagatgttgctgggttctcatgttttgttcttagtgattcattgaatttttgtacgttgctagat 124440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 38; Significance: 0.000000000004; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 557 - 602
Target Start/End: Complemental strand, 7310508 - 7310463
Alignment:
557 gatgatgttgctgttgaattgatgacgatgttgttgctgctattgt 602  Q
    ||||||||||||||||||||||||| | ||||||||||||||||||    
7310508 gatgatgttgctgttgaattgatgatgttgttgttgctgctattgt 7310463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 36; Significance: 0.00000000006; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 535 - 610
Target Start/End: Complemental strand, 11316331 - 11316257
Alignment:
535 atggttcattttgataactagtgatgatgttgctgttgaattgatgacgatgttgttgctgctattgtataatctg 610  Q
    |||||| |||||||||  | |||||||||||| |||||||||||||| | |||||||| ||||||||| |||||||    
11316331 atggtttattttgatagatggtgatgatgttgttgttgaattgatgatgttgttgttg-tgctattgtttaatctg 11316257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 542 - 592
Target Start/End: Original strand, 32470300 - 32470350
Alignment:
542 attttgataactagtgatgatgttgctgttgaattgatgacgatgttgttg 592  Q
    |||||||||  | |||||||||||| |||||||||||||| ||||||||||    
32470300 attttgatagatggtgatgatgttgttgttgaattgatgatgatgttgttg 32470350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 34; Significance: 0.0000000009; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 252 - 305
Target Start/End: Complemental strand, 22552254 - 22552201
Alignment:
252 ggcgttggggttacgactgcgactgcagcgtttgttgcggtggttggaagggga 305  Q
    |||||||||||||||||| ||||  |  ||||||||||||||||||||||||||    
22552254 ggcgttggggttacgactacgacgacgacgtttgttgcggtggttggaagggga 22552201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 555 - 592
Target Start/End: Complemental strand, 32694301 - 32694264
Alignment:
555 gtgatgatgttgctgttgaattgatgacgatgttgttg 592  Q
    ||||||||||||||||||||||||||| ||||||||||    
32694301 gtgatgatgttgctgttgaattgatgatgatgttgttg 32694264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 555 - 592
Target Start/End: Complemental strand, 32797528 - 32797491
Alignment:
555 gtgatgatgttgctgttgaattgatgacgatgttgttg 592  Q
    ||||||||||||||||||||||||||| ||||||||||    
32797528 gtgatgatgttgctgttgaattgatgatgatgttgttg 32797491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 34; Significance: 0.0000000009; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 555 - 592
Target Start/End: Complemental strand, 30858285 - 30858248
Alignment:
555 gtgatgatgttgctgttgaattgatgacgatgttgttg 592  Q
    ||||||||||||||||||||||||||| ||||||||||    
30858285 gtgatgatgttgctgttgaattgatgatgatgttgttg 30858248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 34; Significance: 0.0000000009; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 557 - 602
Target Start/End: Complemental strand, 38241291 - 38241246
Alignment:
557 gatgatgttgctgttgaattgatgacgatgttgttgctgctattgt 602  Q
    |||||||||| |||||||||||||| | ||||||||||||||||||    
38241291 gatgatgttgttgttgaattgatgatgttgttgttgctgctattgt 38241246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0118 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0118
Description:

Target: scaffold0118; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 555 - 592
Target Start/End: Complemental strand, 42683 - 42646
Alignment:
555 gtgatgatgttgctgttgaattgatgacgatgttgttg 592  Q
    |||||||||||| |||||||||||||| ||||||||||    
42683 gtgatgatgttgttgttgaattgatgatgatgttgttg 42646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 426 - 454
Target Start/End: Complemental strand, 33962337 - 33962309
Alignment:
426 aaaaaatgggggagattgcagcatttgtt 454  Q
    |||||||||||||||||||||||||||||    
33962337 aaaaaatgggggagattgcagcatttgtt 33962309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University