View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9381_low_50 (Length: 249)
Name: NF9381_low_50
Description: NF9381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9381_low_50 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 19 - 235
Target Start/End: Complemental strand, 26551132 - 26550916
Alignment:
| Q |
19 |
catgttaccttaaccaaccaaacatgtttcatgctttactttcatagctacaatgatgttgttgcaacgatcaaatttctgtccaattccttcttctcaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26551132 |
catgttaccttaaccaaccaaacatgtttcatgctttacttttatagctacaatgatgttgttgcaacaatcaaatttctgtccaattccttcttctcaa |
26551033 |
T |
|
| Q |
119 |
tttccctcactcaaacaaagaaacccatttcttcatcacctacaatttcgtagaaaggataaagcttccacctttagaatttcttctcttgctgctgctg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26551032 |
tttccctcactcaaacaaagaaacccatttcttcatcacctacaatttcgtagaaaggataaagcttccacctttagaatttcttctcttgctgctgctg |
26550933 |
T |
|
| Q |
219 |
gttttttcaatgatgtc |
235 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
26550932 |
gttttttcaatgatgtc |
26550916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University