View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9381_low_51 (Length: 246)
Name: NF9381_low_51
Description: NF9381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9381_low_51 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 11 - 246
Target Start/End: Complemental strand, 18270554 - 18270320
Alignment:
| Q |
11 |
atggacatcactgtttttgatacaggaaaccctatagattttatccaagtaccaaacaattggcttgtgccgatacaacacattcacctaggaaaacaaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18270554 |
atggacatcactgtttttgatacaggaaaccctatagattttatccaagtatcaaacaattggcttgtgccgatacaacacattcacctaggaaaacaaa |
18270455 |
T |
 |
| Q |
111 |
tgcaccccccacatcacacagagagggagaaggttcattttttacttcacggggttgaaagaaagattttatcatggccttgcacccacttgcaaagagg |
210 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18270454 |
tgcaccccccacatcacacagaga-ggagaaggttcattttttacttcacggggttgaaagaaagattttatcatgcccttgcacccacttgcaaagagg |
18270356 |
T |
 |
| Q |
211 |
tcttcaccagctgagcttttcaacatcttacatcgc |
246 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18270355 |
tcttcaccagctgagcttgtcaacatcttacatcgc |
18270320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University