View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9381_low_60 (Length: 243)

Name: NF9381_low_60
Description: NF9381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9381_low_60
NF9381_low_60
[»] chr7 (1 HSPs)
chr7 (155-243)||(46543020-46543108)


Alignment Details
Target: chr7 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 155 - 243
Target Start/End: Original strand, 46543020 - 46543108
Alignment:
155 ttcaatagcacagtatattcatcataaaagagtcacaactcacaacagtgacccacgaataaatggattaacatccaaatccaatatta 243  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46543020 ttcaatagcacagtatattcatcataaaagagtcacaactcacaacagtgacccacgaataaatggattaacatccaaatccaatatta 46543108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University