View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9381_low_66 (Length: 232)

Name: NF9381_low_66
Description: NF9381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9381_low_66
NF9381_low_66
[»] chr4 (1 HSPs)
chr4 (69-215)||(3048306-3048452)


Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 69 - 215
Target Start/End: Original strand, 3048306 - 3048452
Alignment:
69 ttcacataatgtttatccttggtaaacactgttttatcttatctcatccaaatatgaatttgcaacaaatcatatacaaattctacatatgcatgactat 168  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3048306 ttcacataatgtttatacttggtaaacactgttttatcttatctcatccaaatatgaatttgcaacaaatcatatacaaattctacatatgcatgactat 3048405  T
169 gaataaattgcttgccatggtttttcgtaaaagttatactgatgatg 215  Q
    |||||||||| |||||||||||||| || ||||||||||||||||||    
3048406 gaataaattgtttgccatggttttttgtgaaagttatactgatgatg 3048452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University