View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9381_low_66 (Length: 232)
Name: NF9381_low_66
Description: NF9381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9381_low_66 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 69 - 215
Target Start/End: Original strand, 3048306 - 3048452
Alignment:
| Q |
69 |
ttcacataatgtttatccttggtaaacactgttttatcttatctcatccaaatatgaatttgcaacaaatcatatacaaattctacatatgcatgactat |
168 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3048306 |
ttcacataatgtttatacttggtaaacactgttttatcttatctcatccaaatatgaatttgcaacaaatcatatacaaattctacatatgcatgactat |
3048405 |
T |
 |
| Q |
169 |
gaataaattgcttgccatggtttttcgtaaaagttatactgatgatg |
215 |
Q |
| |
|
|||||||||| |||||||||||||| || |||||||||||||||||| |
|
|
| T |
3048406 |
gaataaattgtttgccatggttttttgtgaaagttatactgatgatg |
3048452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University