View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9381_low_79 (Length: 205)
Name: NF9381_low_79
Description: NF9381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9381_low_79 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 46543324 - 46543199
Alignment:
| Q |
1 |
ggtgcgcttcagaggaacactgtcccatgttctcgccgtggtgcttcttactacaattgcagacccggtgctcaggctaacccttacagtcgtggatgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46543324 |
ggtgcgcttcagaggaacactgtcccatgttctcgccgtggtgcttcttactacaattgcagacccggtgctcaggctaacccttacagtcgtggatgca |
46543225 |
T |
|
| Q |
101 |
gtgctattacgaggtgcaggggttaa |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
46543224 |
gtgctattacgaggtgcaggggttaa |
46543199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 167 - 205
Target Start/End: Complemental strand, 46543155 - 46543117
Alignment:
| Q |
167 |
tgtttatgattaatgatgttgggttgtgaatttttatat |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46543155 |
tgtttatgattaatgatgttgggttgtgaatttttatat |
46543117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 12 - 104
Target Start/End: Original strand, 49671228 - 49671320
Alignment:
| Q |
12 |
gaggaacactgtcccatgttctcgccgtggtgcttcttactacaattgcagacccggtgctcaggctaacccttacagtcgtggatgcagtgc |
104 |
Q |
| |
|
||||||||||||||| || || | |||||||||||||| || ||||| | || |||||||||||||| |||||| | |||||||||||||| |
|
|
| T |
49671228 |
gaggaacactgtcccttgctcaagacgtggtgcttcttattataattgtcggcctggtgctcaggctaatccttaccgccgtggatgcagtgc |
49671320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University