View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9381_low_79 (Length: 205)

Name: NF9381_low_79
Description: NF9381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9381_low_79
NF9381_low_79
[»] chr7 (2 HSPs)
chr7 (1-126)||(46543199-46543324)
chr7 (167-205)||(46543117-46543155)
[»] chr4 (1 HSPs)
chr4 (12-104)||(49671228-49671320)


Alignment Details
Target: chr7 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 46543324 - 46543199
Alignment:
1 ggtgcgcttcagaggaacactgtcccatgttctcgccgtggtgcttcttactacaattgcagacccggtgctcaggctaacccttacagtcgtggatgca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46543324 ggtgcgcttcagaggaacactgtcccatgttctcgccgtggtgcttcttactacaattgcagacccggtgctcaggctaacccttacagtcgtggatgca 46543225  T
101 gtgctattacgaggtgcaggggttaa 126  Q
    ||||||||||||||||||||||||||    
46543224 gtgctattacgaggtgcaggggttaa 46543199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 167 - 205
Target Start/End: Complemental strand, 46543155 - 46543117
Alignment:
167 tgtttatgattaatgatgttgggttgtgaatttttatat 205  Q
    |||||||||||||||||||||||||||||||||||||||    
46543155 tgtttatgattaatgatgttgggttgtgaatttttatat 46543117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 12 - 104
Target Start/End: Original strand, 49671228 - 49671320
Alignment:
12 gaggaacactgtcccatgttctcgccgtggtgcttcttactacaattgcagacccggtgctcaggctaacccttacagtcgtggatgcagtgc 104  Q
    ||||||||||||||| || ||  | |||||||||||||| || |||||  | || |||||||||||||| |||||| | ||||||||||||||    
49671228 gaggaacactgtcccttgctcaagacgtggtgcttcttattataattgtcggcctggtgctcaggctaatccttaccgccgtggatgcagtgc 49671320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University