View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9383_low_11 (Length: 259)
Name: NF9383_low_11
Description: NF9383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9383_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 26611154 - 26611401
Alignment:
| Q |
1 |
tttgagctcattctcctgtttgtgaccaaagctgccagcctcagcatgcaccctctttgaatcaattatataatttcttcttttcatgcatggaggaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26611154 |
tttgagctcattctcctgtttgtgaccaaagctgccagcctcagcatgcaccctctttgaatcaattatataatttcttcttttcatgcatggaggaaaa |
26611253 |
T |
 |
| Q |
101 |
aaggccatttgatgatgatcatagggtccataatatatcttttgttgttgagaaaaca-------nnnnnnnnnatagttatcctttttgttttgttgat |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
26611254 |
aaggccatttgatgatgatcatagggtccataatatatcttctgttgttgagaaaacatatattttttttttttactgttatcctttttgttttgttgat |
26611353 |
T |
 |
| Q |
194 |
ggtaaaaagagaaagttttaggcatctccaatgcatgaaaattaaaaac |
242 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
26611354 |
ggtaaaaagagaaagttttaggcatct-caatgaatgaaaattaaaaac |
26611401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University