View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9383_low_16 (Length: 238)
Name: NF9383_low_16
Description: NF9383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9383_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 18948955 - 18949179
Alignment:
| Q |
1 |
tactaactatgattgaatatccttctaaaataacc-ataaagatattataacaaatcaaaagtcattatacattataacagagctccttggacacaaatt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18948955 |
tactaactatgattgaatatccttctaaaataacccataaagatattataacaaatcaaaagtcattatacattataacagagctccttggacacaaatt |
18949054 |
T |
|
| Q |
100 |
ttaacatcatatatatctcttttcaacttcaatgtcattttttgattattcaatttggtatatctcatttataatagaatgaatccatacacatacgtag |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| |
|
|
| T |
18949055 |
ttaacatcatatatatctcttttcaacttcaatgtcattttttgattattcaatttggtatatctcatttataatagaatgaatccatacagatacatag |
18949154 |
T |
|
| Q |
200 |
gaaaaacaacttaagagtgggaaat |
224 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
18949155 |
gaaaaacaacttaagagtgggaaat |
18949179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University