View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9383_low_17 (Length: 230)
Name: NF9383_low_17
Description: NF9383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9383_low_17 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 25 - 230
Target Start/End: Original strand, 19220015 - 19220220
Alignment:
| Q |
25 |
gcatataaagataaccctaatgaggtatctttaaactatgcattatttcaaccaaatgaaggtttggttgatccaaacacaaatttgcattatgataaca |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19220015 |
gcatataaagataaccctaatgaggtatctttaaactatgcattatttcaaccaaatgaaggtttggttgatccaaacacaaatttgcattatgataaca |
19220114 |
T |
|
| Q |
125 |
tgttatatgctcaaattgatgctgtttatgctgcaatcaaagtgatagggtataccaatgttgaagttaaggtttctgagacaggttggccttcaaatgg |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19220115 |
tgttatatgctcaaattgatgctgtttatgctgcaatcaaagtgatagggtataccaatgttgaagttaaggtttctgagacaggttggccttcaaatgg |
19220214 |
T |
|
| Q |
225 |
cgacgc |
230 |
Q |
| |
|
|||||| |
|
|
| T |
19220215 |
cgacgc |
19220220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 50 - 135
Target Start/End: Complemental strand, 32856601 - 32856516
Alignment:
| Q |
50 |
tatctttaaactatgcattatttcaaccaaatgaaggtttggttgatccaaacacaaatttgcattatgataacatgttatatgct |
135 |
Q |
| |
|
|||||||| |||||| ||||||| | || || |||| |||||||||| || |||||||| ||||||||||||||| | |||||| |
|
|
| T |
32856601 |
tatctttagactatgtattatttaatcctaaccaaggaatggttgatcctaatacaaatttacattatgataacatgctttatgct |
32856516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 103 - 218
Target Start/End: Original strand, 36381724 - 36381839
Alignment:
| Q |
103 |
acaaatttgcattatgataacatgttatatgctcaaattgatgctgtttatgctgcaatcaaagtgatagggtataccaatgttgaagttaaggtttctg |
202 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| ||||| ||||||||||| || || | | ||||| ||| | || | || |||||| |||||| |
|
|
| T |
36381724 |
acaaatttgcattatgataacatgttgtatgctcaaatcgatgccgtttatgctgctataaaggcggtagggcatagcgatatcgaggttaagatttctg |
36381823 |
T |
|
| Q |
203 |
agacaggttggccttc |
218 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
36381824 |
agacaggttggccttc |
36381839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 70 - 126
Target Start/End: Complemental strand, 34869189 - 34869133
Alignment:
| Q |
70 |
tttcaaccaaatgaaggtttggttgatccaaacacaaatttgcattatgataacatg |
126 |
Q |
| |
|
||||||||||| |||| ||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
34869189 |
tttcaaccaaaccaaggaatggttgatccaaaaacaaacctgcattatgataacatg |
34869133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University