View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9384_low_20 (Length: 223)
Name: NF9384_low_20
Description: NF9384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9384_low_20 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 6037342 - 6037566
Alignment:
| Q |
1 |
tactggattttcatcttggagttcagagtatccaatttcttccgcagggnnnnnnnn---ggaaataacgaagaatgataagggaataatattggaggat |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6037342 |
tactggattttcatcttggagttcagagtatccaatttcttccgcagggaaaaaaaaaaaggaaataacgaagaatgataagggaataatattggaggat |
6037441 |
T |
 |
| Q |
98 |
gaaacttcattcgctctgtcttagttcaactaacagatttactagctttgtagaagttagcgatgatggttatagaagttagacgtgactgttagaagat |
197 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6037442 |
gaaactttattcgctctgtct-agttcaactaacagatttactagctttgtagaagttagtgatgatggttatagaatttagacgtgactgttagaagat |
6037540 |
T |
 |
| Q |
198 |
tgttaacagttagttacaaccggtaa |
223 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
6037541 |
tgttaacagttagttacaaccggtaa |
6037566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University